GM CSF Receptor alpha (CSF2RA) (NM_001161531) Human 3' UTR Clone

CAT#: SC200391

3' UTR clone of colony stimulating factor 2 receptor alpha low-affinity (granulocyte-macrophage) (CSF2RA) transcript variant 9 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GM CSF Receptor alpha (CSF2RA) (NM_001161531) Human 3' UTR Clone
Vector pMirTarget
Synonyms alphaGMR; CD116; CDw116; CSF2R; CSF2RAX; CSF2RAY; CSF2RX; CSF2RY; GM-CSF-R-alpha; GMCSFR; GMCSFR-alpha; GMR; GMR-alpha; SMDP4
ACCN NM_001161531
Insert Size 236 bp
Sequence Data
>SC200391 3’UTR clone of NM_001161531
The sequence shown below is from the reference sequence of NM_001161531. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAAGGTTGGGGTCAGAGTCATCTCTGTGAGCTCCATCAGGAGAAACTGAGGCAGGGTGGTGGTCAAGA
AAAGGAGGAGAAGACGGTAGAGAGGGCCAGGCACGGTGGCTCATGCCTGTCATCCCAGCACTTTGGGAG
GTTGAGGCATGTGGATCATCTGAGGTCAGAGGTTCGAGACCAGCCTGGCCAACGTGGTGAAACCCCATC
TCTGCTAAAAATACAAAAAATTAGCTGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001161531.2
Synonyms alphaGMR; CD116; CDw116; CSF2R; CSF2RAX; CSF2RAY; CSF2RX; CSF2RY; GM-CSF-R-alpha; GMCSFR; GMCSFR-alpha; GMR; GMR-alpha; SMDP4
Summary The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
Locus ID 1438
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...