Proteasome subunit alpha type 6 (PSMA6) (NM_002791) Human 3' UTR Clone

CAT#: SC201979

3' UTR clone of proteasome (prosome macropain) subunit alpha type 6 (PSMA6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Proteasome subunit alpha type 6 (PSMA6) (NM_002791) Human 3' UTR Clone
Vector pMirTarget
Synonyms IOTA; p27K; PROS27
ACCN NM_002791
Insert Size 217 bp
Sequence Data
>SC201979 3’UTR clone of NM_002791
The sequence shown below is from the reference sequence of NM_002791. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCTTGTTGCTCTAGCAGAGAGAGACTAAACATTGTCGTTAGTTTACCAGATCCGTGATGCCACTTAC
CTGTGTGTTTGGTAACAACAAACCAACATCATGGAGGTCCCTGGATTGAAAAAGGAGCCTCTCCCACTC
CTCCTACCACCGAAGTGGTTAGGACTCTATATAAATAAAAACAAGGCTTTTGGAAAATAATTGCATCCT
GTTGTTTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002791.3
Synonyms IOTA; p27K; PROS27
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]
Locus ID 5687
MW 8.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...