Igf1 (NM_001111276) Mouse Untagged Clone
CAT#: MC208755
Igf1 (untagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 5, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C730016P09Rik; Igf; Igf-; Igf-1; Igf-I |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208755 representing NM_001111276
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCGCACCTGCAATAAAGATACACATCATGTCGTCTTCACACCTCTTCTACCTGGCGCTCTGCTTGC TCACCTTCACCAGCTCCACCACAGCTGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGATGCTCTTCA GTTCGTGTGTGGACCGAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCA CCTCAGACAGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGACTGGAGATGTACTGTG CCCCACTGAAGCCTACAAAAGCAGCCCGCTCTATCCGTGCCCAGCGCCACACTGACATGCCCAAGACTCA GAAGGAAGTACATTTGAAGAACACAAGTAGAGGAAGTGCAGGAAACAAGACCTACAGAATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001111276 |
Insert Size | 414 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001111276.1, NP_001104746.1 |
RefSeq Size | 6987 bp |
RefSeq ORF | 414 bp |
Locus ID | 16000 |
Gene Summary | This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (5) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation from a distinct start codon and result in an isoform (5) with novel N- and C-termini, compared to isoform 1. This isoform (5) is also known as IIA. This isoform (5) may undergo proteolytic processing similar to isoform 4. Sequence Note: This RefSeq was created from transcript and genomic sequence because transcript sequence consistent with the reference assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227069 | Igf1 (tGFP-tagged) - Mouse insulin-like growth factor 1 (Igf1) transcript variant 5, (10ug) |
CNY 2,090.00 |
|
MR227069 | Igf1 (Myc-DDK-tagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 5 |
CNY 1,900.00 |
|
MR227069L3 | Lenti ORF clone of Igf1 (Myc-DDK-tagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 5 |
CNY 3,800.00 |
|
MR227069L4 | Lenti ORF clone of Igf1 (mGFP-tagged) - Mouse insulin-like growth factor 1 (Igf1), transcript variant 5 |
CNY 3,800.00 |