United States
Germany
Japan
United Kingdom
China
Fxyd4 (NM_033648) Mouse Untagged Clone
CAT＃: MC212162
Fxyd4 (untagged) - Mouse FXYD domain-containing ion transport regulator 4 (Fxyd4), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610008I02Rik; AI267073; Chi; Chif |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212162 representing NM_033648
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGAAATCACCTGTGCCTTTCTCCTGCTGCTAGCAGGTCTGCCGGCCTTGGAAGCCAGTGACCCAG TTGATAAAGACAGTCCCTTCTACTATGACTGGGAGAGCCTGCAGCTGGGAGGATTGATTTTTGGAGGGCT CCTGTGCATCGCTGGAATTGCCATGGCCCTGAGTGGCAAGTGCAAATGTAGGCGTACCCATAAGCCCAGT TCCTTACCTGGAAAAGCCACTCCACTCATCATTCCAGGCTCTGCCAATACCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_033648 |
| Insert Size | 267 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_033648.1, NP_387468.1 |
| RefSeq Size | 554 bp |
| RefSeq ORF | 267 bp |
| Locus ID | 108017 |
| UniProt ID | Q9D2W0 |
| Gene Summary | This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG219235 | Fxyd4 (tGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 4 (Fxyd4) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
| MR219235 | Fxyd4 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 4 (Fxyd4), transcript variant 1 |
CNY 1,200.00 |
|
| MR219235L3 | Lenti ORF clone of Fxyd4 (Myc-DDK-tagged) - Mouse FXYD domain-containing ion transport regulator 4 (Fxyd4), transcript variant 1 |
CNY 4,750.00 |
|
| MR219235L4 | Lenti ORF clone of Fxyd4 (mGFP-tagged) - Mouse FXYD domain-containing ion transport regulator 4 (Fxyd4), transcript variant 1 |
CNY 4,750.00 |
