Nrep (NM_001267717) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	AI325076; D0H4S114; Harp; P311; PTZ17; SEZ17
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225501 representing NM_001267717 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTTACTACCCAGAACTCTTGGTCTGGGTCAGCCAAGAACCGTTTGCATACAAGGAAATGGAGGGAG GTCTTATTAAGGGAAGACTTCCCGTGCCTAAGGAAGTGAACCGAAAGAAGATGGAGGAGACTGGCGCTGC CTCGCTGACTCCGCCAGGCAGCCGTGAATTCACCTCTCCAGCTACCAGTTACCTCCACCCTTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001267717
Insert Size	207 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001267717.1, NP_001254646.1
RefSeq Size	2097 bp
RefSeq ORF	207 bp
Locus ID	27528
UniProt ID	Q07475
Gene Summary	May have roles in cellular differentiation. Ectopic expression induces differentiation of fibroblast into myofibroblast and myofibroblast ameboid migration. Increases retinoic-acid regulation of lipid-droplet biogenesis. May also have neural functions. Promotes axonal regeneration and augments motility of gliomas. Down-regulates the expression of TGFB1 and TGFB2 but not of TGFB3. May play a role in the regulation of alveolar generation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4 and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcripts of different breeds and genomic sequence data because no single transcript from the same breed was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.