RANTES (CCL5) (AK094877) Human Untagged Clone

CAT#: SC104452

(untagged)-Human cDNA FLJ37558 fis, clone BRCOC1000087



CNY 1,200.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
CCL5 mouse monoclonal antibody, clone OTI2A7 (formerly 2A7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 4930578C19Rik; bA435K1.1; DIA1R; EPQL1862; PRO3743
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for AK094877, the custom clone sequence may differ by one or more nucleotides


ATGTTCGGCGTCTTTAGCAACGGGCATCTGTTCATCCGGGATGCCAGTGCAGTGGGCGTCATCGACAAGC
AGGAAGGCAGCCAAGAAGCCAACAGGGCAGGAGAGAATAAAGACATTTTTAGCTGCCTGGTTTCCGGCTG
CCAGGCCCAGCTGCCCTCCTGCGAAAGCATCTCTGAGAAGCAGAGCCTGGTGCTGGTGTGTCAGAAGTTG
CTGCCTCGACTTCTCCAGGGGAGGTTCCCCTCCCCAGTGCAAGACGACATAGACTCCATCCTTGTTCAGT
GTGGGGACAGCATCCGCCCAGACCCAGAAGTCCTTGGGGCCGCCAGCCAGCTGAAAGACATCTTGAGGCC
CCTGAGAACGTGTGACTCCAGATTTGCCTATCGTTACCCAGATTGCAAATATAACGATAAGTTCTGA


>OriGene 5' read for AK094877 unedited
NNTTCATATCCCCCGCCCGTTGACGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTAT
ATAAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCG
GCCGCGAATTCGGCACGAGGAACGATTTGAACTATTTCTTCTACTTCACCCACATTGATG
CAGGCATGTTCGGCGTCTTTAACAACGGGCATCTGTTCATCCGGGATGCCAGTGCAGTGG
GCGTCATCGACAAGCAGGAAGGCAGCCAAGAAGCCAACAGGGCAGGAGAGAATAAAGACA
TTTTTAGCTGCCTGGTTTCCGGCTGCCAGGCCCAGCTGCCCTCCTGCGAAAGCATCTCTG
AGAAGCAGAGCCTGGTGCTGGTGTGTCAGAAGTTGCTGCCTCGACTTCTCCAGGGGAGGT
TCCCCTCCCCAGTGCAAGACGACATAGACTCCATCCTTGTTCAGTGTGGGGACAGCATCC
GCCCAGACCCAGAAGTCCTTGGGGCCGCCAGCCAGCTGAAAGACATCTTGAGGCCCCTGA
GAACGTGTGACTCCAGATTTGCCTATCGTTACCCAGAGTGCAAATATAACGATAAGTTCT
GAAGGGCTGGTGTCTAGCTGGCCTTGGGGACAACACGCTTGGCTCTCCATTCTCCCAGTC
GGGTTGCTGCAAGGTAGAAAGAAGCAGCTCTTTTTTAAAGATGAGAAGAAAGGCACACTC
ATTTCTTAGGGACTGAGACGGGGNACGTTGTGAGATACCCGGTTGGCTGTCTCTGCTGGC
TTTGGGACGTCCTGGCAAGCCCCGCGGTGGGCATCAAGACCCTGGGGTTGGTGGACGCTC
ACTCATGGTCTTGAGAGCTCAGTTTCCTCTATTCTNCACAACTCTCCTTTGGGGGGTGGA
AAGAAGACACAGATGTAGCCCC
Restriction Sites NotI-NotI     
ACCN AK094877
Insert Size 4200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK094877.1, BAC04447.1
RefSeq Size 2354 bp
RefSeq ORF 417 bp
Locus ID 6352
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, NOD-like receptor signaling pathway, Prion diseases, Toll-like receptor signaling pathway
Gene Summary This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor chemokine (C-C motif) receptor 5 (CCR5), and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...