RPS16 (NM_001020) Human Untagged Clone
CAT#: SC119527
RPS16 (untagged)-Human ribosomal protein S16 (RPS16)
CNY 1,800.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | S16 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001020, the custom clone sequence may differ by one or more nucleotides
ATGCCGTCCAAGGGCCCGCTGCAGTCTGTGCAGGTCTTCGGACGCAAGAAGACAGCGACAGCTGTGGCGC ACTGCAAACGCGGCAATGGTCTCATCAAGGTGAACGGGCGGCCCCTGGAGATGATTGAGCCGCGCACGCT ACAGTACAAGCTGCTGGAGCCAGTTCTGCTTCTCGGCAAGGAGCGATTTGCTGGTGTAGACATCCGTGTC CGTGTAAAGGGTGGTGGTCACGTGGCCCAGATTTATGCTATCCGTCAGTCCATCTCCAAAGCCCTGGTGG CCTATTACCAGAAATATGTGGATGAGGCTTCCAAGAAGGAGATCAAAGACATCCTCATCCAGTATGACCG GACCCTGCTGGTAGCTGACCCTCGTCGCTGCGAGTCCAAAAAGTTTGGAGGCCCTGGTGCCCGCGCTCGC TACCAGAAATCCTACCGATAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_001020 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001020.4, NP_001011.1 |
RefSeq Size | 603 bp |
RefSeq ORF | 441 bp |
Locus ID | 6217 |
UniProt ID | P62249 |
Domains | Ribosomal_S9 |
Protein Pathways | Ribosome |
Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S9P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203475 | RPS16 (Myc-DDK-tagged)-Human ribosomal protein S16 (RPS16) |
CNY 1,800.00 |
|
RC203475L3 | Lenti ORF clone of Human ribosomal protein S16 (RPS16), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203475L4 | Lenti ORF clone of Human ribosomal protein S16 (RPS16), mGFP tagged |
CNY 5,890.00 |
|
RG203475 | RPS16 (tGFP-tagged) - Human ribosomal protein S16 (RPS16) |
CNY 3,400.00 |