PDE9A (NM_001001584) Human Untagged Clone

CAT#: SC300237

PDE9A (untagged)-Human phosphodiesterase 9A (PDE9A), transcript variant 19



  "NM_001001584" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PDE9A Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPDE9A2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001001584, the custom clone sequence may differ by one or more nucleotides
ATGAGGGAGGAGCTGGCGGCCAGAAGCAGCAGGACCAACTGCCCCTGTAAGTACAGTTTT
TTGGATAACCACAAGAAGTTGACTCCTCGACGCGATGTTCCCACTTACCCCAAGTACCTG
CTCTCTCCAGAGACCATCGAGGCCCTGCGGAAGCCGACCTTTGACGTCTGGCTTTGGGAG
CCCAATGAGATGCTGAGCTGCCTGGAGCACATGTACCACGACCTCGGGCTGGTCAGGGAC
TTCAGCATCAACCCTGTCACCCTCAGGAGGTGGCTGTTCTGCGTCCACGACAACTACAGA
AACAACCCCTTCCACAACTTCCGGCACTGCTTCTGCGTGGCCCAGATGATGTACAGCATG
GTCTGGCTCTGCAGTCTCCAGGAGAAGTTCTCACAAACGGATATCCTGATCCTAATGACA
GCGGCCATCTGCCACGATCTGGACCATCCCGGCTACAACAACACGTACCAGATCAATGCC
CGCACAGAGCTGGCGGTCCGCTACAATGACATCTCACCGCTGGAGAACCACCACTGCGCC
GTGGCCTTCCAGATCCTCGCCGAGCCTGAGTGCAACATCTTCTCCAACATCCCACCTGAT
GGGTTCAAGCAGATCCGACAGGGAATGATCACATTAATCTTGGCCACTGACATGGCAAGA
CATGCAGAAATTATGGATTCTTTCAAAGAGAAAATGGAGAATTTTGACTACAGCAACGAG
GAGCACATGACCCTGCTGAAGATGATTTTGATAAAATGCTGTGATATCTCTAACGAGGTC
CGTCCAATGGAAGTCGCAGAGCCTTGGGTGGACTGTTTATTAGAGGAATATTTTATGCAG
AGCGACCGTGAGAAGTCAGAAGGCCTTCCTGTGGCACCGTTCATGGACCGAGACAAAGTG
ACCAAGGCCACAGCCCAGATTGGGTTCATCAAGTTTGTCCTGATCCCAATGTTTGAAACA
GTGACCAAGCTCTTCCCCATGGTTGAGGAGATCATGCTGCAGCCACTTTGGGAATCCCGA
GATCGCTACGAGGAGCTGAAGCGGATAGATGACGCCATGAAAGAGTTACAGAAGAAGACT
GACAGCTTGACGTCTGGGGCCACCGAGAAGTCCAGAGAGAGAAGCAGAGATGTGAAAAAC
AGTGAAGGAGACTGTGCCTGA
Restriction Sites Please inquire     
ACCN NM_001001584
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001584.1, NP_001001584.1
RefSeq Size 1852 bp
RefSeq ORF 1161 bp
Locus ID 5152
UniProt ID O76083
Protein Families Druggable Genome
Protein Pathways Progesterone-mediated oocyte maturation, Purine metabolism
Gene Summary The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (19) contains an alternate exon and lacks three others compared to variant 1. The resulting predicted isoform (g) has a shorter N-terminus compared to isoform a. Variants 7, 8, 14, 19, and 20 all encode isoform g. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...