CHRM2 (NM_001006630) Human Untagged Clone

CAT#: SC301091

CHRM2 (untagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1



  "NM_001006630" in other vectors (6)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
Rabbit polyclonal anti-CHRM2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HM2
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001006630, the custom clone sequence may differ by one or more nucleotides


ATGAATAACTCAACAAACTCCTCTAACAATAGCCTGGCTCTTACAAGTCCTTATAAGACATTTGAAGTGG
TGTTTATTGTCCTGGTGGCTGGATCCCTCAGTTTGGTGACCATTATCGGGAACATCCTAGTCATGGTTTC
CATTAAAGTCAACCGCCACCTCCAGACCGTCAACAATTACTTTTTATTCAGCTTGGCCTGTGCTGACCTT
ATCATAGGTGTTTTCTCCATGAACTTGTACACCCTCTACACTGTGATTGGTTACTGGCCTTTGGGACCTG
TGGTGTGTGACCTTTGGCTAGCCCTGGACTATGTGGTCAGCAATGCCTCAGTTATGAATCTGCTCATCAT
CAGCTTTGACAGGTACTTCTGTGTCACAAAACCTCTGACCTACCCAGTCAAGCGGACCACAAAAATGGCA
GGTATGATGATTGCAGCTGCCTGGGTCCTCTCTTTCATCCTCTGGGCTCCAGCCATTCTCTTCTGGCAGT
TCATTGTAGGGGTGAGAACTGTGGAGGATGGGGAGTGCTACATTCAGTTTTTTTCCAATGCTGCTGTCAC
CTTTGGTACGGCTATTGCAGCCTTCTATTTGCCAGTGATCATCATGACTGTGCTATATTGGCACATATCC
CGAGCCAGCAAGAGCAGGATAAAGAAGGACAAGAAGGAGCCTGTTGCCAACCAAGACCCCGTTTCTCCAA
GTCTGGTACAAGGAAGGATAGTGAAGCCAAACAATAACAACATGCCCAGCAGTGACGATGGCCTGGAGCA
CAACAAAATCCAGAATGGCAAAGCCCCCAGGGATCCTGTGACTGAAAACTGTGTTCAGGGAGAGGAGAAG
GAGAGCTCCAATGACTCCACCTCAGTCAGTGCTGTTGCCTCTAATATGAGAGATGATGAAATAACCCAGG
ATGAAAACACAGTTTCCACTTCCCTGGGCCATTCCAAAGATGAGAACTCTAAGCAAACATGCATCAGAAT
TGGCACCAAGACCCCAAAAAGTGACTCATGTACCCCAACTAATACCACCGTGGAGGTAGTGGGGTCTTCA
GGTCAGAATGGAGATGAAAAGCAGAATATTGTAGCCCGCAAGATTGTGAAGATGACTAAGCAGCCTGCAA
AAAAGAAGCCTCCTCCTTCCCGGGAAAAGAAAGTCACCAGGACAATCTTGGCTATTCTGTTGGCTTTCAT
CATCACTTGGGCCCCATACAATGTCATGGTGCTCATTAACACCTTTTGTGCACCTTGCATCCCCAACACT
GTGTGGACAATTGGTTACTGGCTTTGTTACATCAACAGCACTATCAACCCTGCCTGCTATGCACTTTGCA
ATGCCACCTTCAAGAAGACCTTTAAACACCTTCTCATGTGTCATTATAAGAACATAGGCGCTACAAGGTA
A


Restriction Sites NotI-NotI     
ACCN NM_001006630
Insert Size 4500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone is found to be a perfect match to NM_001006630.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006630.1, NP_001006631.1
RefSeq Size 2782 bp
RefSeq ORF 1401 bp
Locus ID 1129
UniProt ID P08172
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Regulation of actin cytoskeleton
Gene Summary The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine to these receptors and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 2 is involved in mediation of bradycardia and a decrease in cardiac contractility. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 through 8 encode the same protein (isoform a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...