United States
Germany
Japan
United Kingdom
China
C1orf103 (LRIF1) (NM_001006945) Human Untagged Clone
CAT＃: SC301128
LRIF1 (untagged)-Human ligand dependent nuclear receptor interacting factor 1 (LRIF1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C1orf103; HBiX1; RIF1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001006945, the custom clone sequence may differ by one or more nucleotides
ATGGCATCAACATCAGATAAAGGTGCCCAAGGAAGAAATGACAAGAAAGATTCTCAAGGA AGAAGTAATAAGGCATTACATCTGAAGAGTGATGCTGAATTTAAAAAGATATTTGGCCTT ACTAAGGATTTGAGAGTGTGCCTTACTCGAATTCCTGACCATTTGACCTCTGGAGAAGGT TTCGATTCCTTTAGCAGTTTGGTAAAGAGTGGTACTTACAAAGAGACAGAGTTTATGGTG AAGGAAGGAGAGAGAAAACAGCAGAATTTTGATAAGAAAAGAAAAGCAAAAACTAATAAG AAGATGGATCACATAAAGAAGAGAAAAACAGAGAATGCTTATAACGCAATCATAAATGGG GAAGCTAATGTCACCGGTTCCCAACTCCTAAGCAGTATTTTACCAACTTCAGATGTGTCA CAACATAACATTCTCACGAGTCACAGCAAAACCAGACAAGAAAAGAGAACTGAGATGGAA TACTATACCCATGAGAAGCAAGAGAAAGGCACTTTGAATTCAAATGCAGCTTATGAACAA AGTCATTTCTTCAATAAAAATTATACCGAAGATATTTTCCCAGTGACACCACCGGAGTTA GAAGAAACCATTCGAGATGAAAAAATAAGAAGACTTAAGCAGGTGCTGAGAGAGAAAGAA GCAGCTCTTGAAGAAATGCGTAAGAAGATGCACCAAAAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001006945 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001006945.1, NP_001006946.1 |
| RefSeq Size | 1821 bp |
| RefSeq ORF | 702 bp |
| Locus ID | 55791 |
| UniProt ID | Q5T3J3 |
| Protein Families | Stem cell - Pluripotency |
| Gene Summary | Together with SMCHD1, involved in chromosome X inactivation in females by promoting the compaction of heterochromatin (PubMed:23542155). Also able to repress the ligand-induced transcriptional activity of retinoic acid receptor alpha (RARA), possibly through direct recruitment of histone deacetylases (PubMed:17455211).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an internal coding exon, compared to variant 1, and encodes a shorter predicted isoform (2) compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203729 | LRIF1 (Myc-DDK-tagged)-Human ligand dependent nuclear receptor interacting factor 1 (LRIF1), transcript variant 2 |
CNY 4,370.00 |
|
| RC203729L3 | Lenti-ORF clone of LRIF1 (Myc-DDK-tagged)-Human ligand dependent nuclear receptor interacting factor 1 (LRIF1), transcript variant 2 |
CNY 6,270.00 |
|
| RC203729L4 | Lenti-ORF clone of LRIF1 (mGFP-tagged)-Human ligand dependent nuclear receptor interacting factor 1 (LRIF1), transcript variant 2 |
CNY 6,270.00 |
|
| RG203729 | LRIF1 (tGFP-tagged) - Human ligand dependent nuclear receptor interacting factor 1 (LRIF1), transcript variant 2 |
CNY 4,850.00 |
