Sterol carrier protein 2 (SCP2) (NM_001007100) Human Untagged Clone

CAT#: SC301155

SCP2 (untagged)-Human sterol carrier protein 2 (SCP2), transcript variant 4



  "NM_001007100" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SCP2 mouse monoclonal antibody, clone OTI1E4 (formerly 1E4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NLTP; NSL-TP; SCOX; SCP-2; SCP-CHI; SCP-X; SCPX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301155 representing NM_001007100.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTTTTCCGGAAGCCGCCAGAACTCATCAAATTGAAGCTGTTCCAACCAGCTCTGCAAGTGATGGA
TTTAAGGCAAATCTTGTTTTTAAGGAGATTGAGAAGAAACTTGAAGAGGAAGGGGAACAGTTTGTGAAG
AAAATCGGTGGTATTTTTGCCTTCAAGGTGAAAGATGGCCCTGGGGGTAAAGAGGCCACCTGGGTGGTG
GATGTGAAGAATGGCAAAGGATCAGTGCTTCCTAACTCAGATAAGAAGGCTGACTGCACAATCACAATG
GCTGACTCAGACTTCCTGGCTTTAATGACTGGTAAAATGAATCCTCAGTCGGCCTTCTTTCAAGGCAAA
TTGAAAATCACTGGCAACATGGGTCTCGCTATGAAGTTACAAAATCTTCAGCTTCAGCCAGGCAACGCT
AAGCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001007100
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001007100.2
RefSeq Size 1419 bp
RefSeq ORF 423 bp
Locus ID 6342
UniProt ID P22307
Protein Pathways Metabolic pathways, PPAR signaling pathway, Primary bile acid biosynthesis
MW 15.1 kDa
Gene Summary This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
Transcript Variant: This variant (4) results from transcription initiation from a downstream promoter. This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. It is unknown whether this isoform (4) is proteolytically processed like isoforms 1 and 5. CCDS Note: This CCDS ID represents a variant of the SCP2 locus that uses a downstream promoter, known as the SCP2 promoter. This promoter initiates transcription in an internal exon compared to the longer CCDS572.1 variant, which uses the upstream SCPx promoter. Data in PMIDs 7654720, 7698762 and 14563822, as well as chromatin regulatory features (including Ensembl ENSR00000282553 and ENSR00000282554), support the presence of an active downstream SCP2 promoter.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...