United States
Germany
Japan
United Kingdom
China
Nkx2.2 (NKX2-2) (NM_002509) Human Untagged Clone
CAT＃: SC303209
NKX2 (untagged)-Human NK2 homeobox 2 (NKX2-2)
CNY 2,400.00
CNY 6,270.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NKX2.2; NKX2B |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_002509 edited
TGCGACATAAATTTTGGGGTCTCGAACCATGTCGCTGACCAACACAAAGACGGGGTTTTC GGTCAAGGACATCTTAGACCTGCCGGACACCAACGATGAGGAGGGCTCTGTGGCCGAAGG TCCGGAGGAAGAGAACGAGGGGCCCGAGCCAGCCAAGAGGGCCGGGCCGCTGGGGCAGGG CGCCCTGGACGCGGTGCAGAGCCTGCCCCTGAAGAACCCCTTCTACGACAGCAGCGACAA CCCGTACACGCGCTGGCTGGCCAGCACCGAGGGCCTTCAGTACTCCCTGCACGGTCTGGC TGCCGGGGCGCCCCCTCAGGACTCAAGCTCCAAGTCCCCGGAGCCCTCGGCCGACGAGTC ACCGGACAATGACAAGGAGACCCCGGGCGGCGGGGGGGACGCCGGCAAGAAGCGAAAGCG GCGAGTGCTTTTCTCCAAGGCGCAGACCTACGAGCTGGAGCGGCGCTTTCGGCAGCAGCG GTACCTGTCGGCGCCCGAGCGCGAACACCTGGCCAGCCTCATCCGCCTCACGCCCACGCA GGTCAAGATCTGGTTCCAGAACCACCGCTACAAGATGAAGCGCGCCCGGGCCGAGAAAGG TATGGAGGTGACGCCCCTGCCCTCGCCGCGCCGGGTGGCCGTGCCCGTCTTGGTCAGGGA CGGCAAACCATGTCACGCGCTCAAAGCCCAGGACCTGGCAGCCGCCACCTTCCAGGCGGG CATTCCCTTTTCTGCCTACAGCGCGCAGTCGCTGCAGCACATGCAGTACAACGCCCAGTA CAGCTCGGCCAGCACCCCCCAGTACCCGACAGCACACCCCCTGGTCCAGGCCCAGCAGTG GACTTGGTGAGCGCCGCCCCAACGAGACTC |
| Restriction Sites | Please inquire |
| ACCN | NM_002509 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002509.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002509.2, NP_002500.1 |
| RefSeq Size | 2092 bp |
| RefSeq ORF | 822 bp |
| Locus ID | 4821 |
| UniProt ID | O95096 |
| Protein Families | Transcription Factors |
| Protein Pathways | Maturity onset diabetes of the young |
| Gene Summary | The protein encoded by this gene contains a homeobox domain and may be involved in the morphogenesis of the central nervous system. This gene is found on chromosome 20 near NKX2-4, and these two genes appear to be duplicated on chromosome 14 in the form of TITF1 and NKX2-8. The encoded protein is likely to be a nuclear transcription factor. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Deregulated expression of NKL homeobox genes in T-cell lymphomas
,Nagel, S;Pommerenke, C;MacLeod, RAF;Meyer, C;Kaufmann, M;Fähnrich, S;Drexler, HG;,
Oncotarget
,PubMed ID 31143370
[NKX2-2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210419 | NKX2 (Myc-DDK-tagged)-Human NK2 homeobox 2 (NKX2-2) |
CNY 2,400.00 |
|
| RC210419L1 | Lenti ORF clone of Human NK2 homeobox 2 (NKX2-2), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC210419L2 | Lenti ORF clone of Human NK2 homeobox 2 (NKX2-2), mGFP tagged |
CNY 5,890.00 |
|
| RC210419L3 | Lenti ORF clone of Human NK2 homeobox 2 (NKX2-2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC210419L4 | Lenti ORF clone of Human NK2 homeobox 2 (NKX2-2), mGFP tagged |
CNY 4,800.00 |
|
| RG210419 | NKX2 (tGFP-tagged) - Human NK2 homeobox 2 (NKX2-2) |
CNY 4,000.00 |
