MCP3 (CCL7) (NM_006273) Human Untagged Clone

CAT#: SC303764

CCL7 (untagged)-Human chemokine (C-C motif) ligand 7 (CCL7)



  "NM_006273" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CCL7 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FIC; MARC; MCP-3; MCP3; NC28; SCYA6; SCYA7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_006273 edited
GCAGAGGGGCTGAGACCAAACCAGAAACCTCCAATTCTCATGTGGAAGCCCATGCCCTCA
CCCTCCAACATGAAAGCCTCTGCAGCACTTCTGTGTCTGCTGCTCACAGCAGCTGCTTTC
AGCCCCCAGGGGCTTGCTCAGCCAGTTGGGATTAATACTTCAACTACCTGCTGCTACAGA
TTTATCAATAAGAAAATCCCTAAGCAGAGGCTGGAGAGCTACAGAAGGACCACCAGTAGC
CACTGTCCCCGGGAAGCTGTAATCTTCAAGACCAAACTGGACAAGGAGATCTGTGCTGAC
CCCACACAGAAGTGGGTCCAGGACTTTATGAAGCACCTGGACAAGAAAACCCAAACTCCA
AAGCTTTGAACATTCATGACTGAACTGAAAACAAGCCATGACTTGAGAAACAAATAATTT
GTATACCCTGTCCTTTCTCAGAGTGGTTCTGAGATTATTTTAATCTAATTCTAAGGAATA
TGAGCTTTATGTAATAATGTGAATCATGGTTTTTCTTAGTAGATTTTAAAAGTTATTAAT
ATTTTAATTTAATCTTCCATGGATTTTGGTGGGTTTTGAACATAAAGCCTTGGATGTATA
TGTCATCTCAGTGCTGTAAAAACTGTGGGATGCTCCTCCCTTCTCTACCTCATGGGGGTA
TTGTATAAGTCCTTGCAAGAATCAGTGCAAAGATTTGCTTTAATTGTTAAGATATGATGT
CCCTATGGAAGCATATTGTTATTATATAATTACATATTTGCATATGTATGACTCCCAAAT
TTTCACATAAAATAGATTTTTGTATAACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_006273
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006273.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006273.2, NP_006264.2
RefSeq Size 810 bp
RefSeq ORF 300 bp
Locus ID 6354
UniProt ID P80098
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction, NOD-like receptor signaling pathway
Gene Summary This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...