United States
Germany
Japan
United Kingdom
China
FGF8 (NM_033164) Human Untagged Clone
CAT＃: SC305581
FGF8 (untagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant E
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AIGF; FGF-8; HBGF-8; HH6; KAL6 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_033164 edited
ATGGGCAGCCCCCGCTCCGCGCTGAGCTGCCTGCTGTTGCACTTGCTGGTCCTCTGCCTC CAAGCCCAGGAAGGCCCGGGCAGGGGCCCTGCGCTGGGCAGGGAGCTCGCTTCCCTGTTC CGGGCTGGCCGGGAGCCCCAGGGTGTCTCCCAACAGCATGTGAGGGAGCAGAGCCTGGTG ACGGATCAGCTCAGCCGCCGCCTCATCCGGACCTACCAACTCTACAGCCGCACCAGCGGG AAGCACGTGCAGGTCCTGGCCAACAAGCGCATCAACGCCATGGCAGAGGACGGCGACCCC TTCGCAAAGCTCATCGTGGAGACGGACACCTTTGGAAGCAGAGTTCGAGTCCGAGGAGCC GAGACGGGCCTCTACATCTGCATGAACAAGAAGGGGAAGCTGATCGCCAAGAGCAACGGC AAAGGCAAGGACTGCGTCTTCACGGAGATTGTGCTGGAGAACAACTACACAGCGCTGCAG AATGCCAAGTACGAGGGCTGGTACATGGCCTTCACCCGCAAGGGCCGGCCCCGCAAGGGC TCCAAGACGCGGCAGCACCAGCGTGAGGTCCACTTCATGAAGCGGCTGCCCCGGGGCCAC CACACCACCGAGCAGAGCCTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGC CTGCGCGGCAGCCAGAGGACTTGGGCCCCCGAGCCCCGATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_033164 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_033164.1, NP_149354.1 |
| RefSeq Size | 1074 bp |
| RefSeq ORF | 702 bp |
| Locus ID | 2253 |
| UniProt ID | P55075 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (E) uses an alternate splice site, compared to variant F. The encoded isoform (E) is shorter than isoform F. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214574 | FGF8 (Myc-DDK-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant E |
CNY 3,990.00 |
|
| RC214574L3 | Lenti-ORF clone of FGF8 (Myc-DDK-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant E |
CNY 5,890.00 |
|
| RC214574L4 | Lenti-ORF clone of FGF8 (mGFP-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant E |
CNY 5,890.00 |
|
| RG214574 | FGF8 (tGFP-tagged) - Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant E |
CNY 4,370.00 |
