CYP26A1 (NM_057157) Human Untagged Clone

CAT#: SC305741

CYP26A1 (untagged)-Human cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 2



  "NM_057157" in other vectors (4)

CNY 6,840.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal Cytochrome P450 26A1 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CP26; CYP26; P450RAI; P450RAI1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305741 representing NM_057157.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCGCAGGAAATACGGCTTCATCTACAAGACGCATCTGTTCGGGCGGCCCACCGTACGGGTGATG
GGCGCGGACAATGTGCGGCGCATCTTGCTCGGAGAGCACCGGCTGGTGTCGGTCCACTGGCCAGCGTCG
GTGCGCACCATTCTGGGATCTGGCTGCCTCTCTAACCTGCACGACTCCTCGCACAAGCAGCGCAAGAAG
GTGATTATGCGGGCCTTCAGCCGCGAGGCACTCGAATGCTACGTGCCGGTGATCACCGAGGAAGTGGGC
AGCAGCCTGGAGCAGTGGCTGAGCTGCGGCGAGCGCGGCCTCCTGGTCTACCCCGAGGTGAAGCGCCTC
ATGTTCCGAATCGCCATGCGCATCCTACTGGGCTGCGAACCCCAACTGGCGGGCGACGGGGACTCCGAG
CAGCAGCTTGTGGAGGCCTTCGAGGAAATGACCCGCAATCTCTTCTCGCTGCCCATCGACGTGCCCTTC
AGCGGGCTGTACCGGGGCATGAAGGCGCGGAACCTCATTCACGCGCGCATCGAGCAGAACATTCGCGCC
AAGATCTGCGGGCTGCGGGCATCCGAGGCGGGCCAGGGCTGCAAAGACGCGCTGCAGCTGTTGATCGAG
CACTCGTGGGAGAGGGGAGAGCGGCTGGACATGCAGGCACTAAAGCAATCTTCAACCGAACTCCTCTTT
GGAGGACACGAAACCACGGCCAGTGCAGCCACATCTCTGATCACTTACCTGGGGCTCTACCCACATGTT
CTCCAGAAAGTGCGAGAAGAGCTGAAGAGTAAGGGTTTACTTTGCAAGAGCAATCAAGACAACAAGTTG
GACATGGAAATTTTGGAACAACTTAAATACATCGGGTGTGTTATTAAGGAGACCCTTCGACTGAATCCC
CCAGTTCCAGGAGGGTTTCGGGTTGCTCTGAAGACTTTTGAATTAAATGGATACCAGATTCCCAAGGGC
TGGAATGTTATCTACAGTATCTGTGATACTCATGATGTGGCAGAGATCTTCACCAACAAGGAAGAATTT
AATCCTGACCGATTCATGCTGCCTCACCCAGAGGATGCATCCAGGTTCAGCTTCATTCCATTTGGAGGA
GGCCTTAGGAGCTGTGTAGGCAAAGAATTTGCAAAAATTCTTCTCAAAATATTTACAGTGGAGCTGGCC
AGGCATTGTGACTGGCAGCTTCTAAATGGACCTCCTACAATGAAAACCAGTCCCACCGTGTATCCTGTG
GACAATCTCCCTGCAAGATTCACCCATTTCCATGGGGAAATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_057157
Insert Size 1287 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_057157.2
RefSeq Size 2245 bp
RefSeq ORF 1287 bp
Locus ID 1592
UniProt ID O43174
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Retinol metabolism
MW 48.6 kDa
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an alternate 5' end region, which doesn't contain an in-frame translation start codon, when compared to variant 1. Translation thus begins at a downstream start codon, and results in a N-terminal truncated protein, as compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...