United States
Germany
Japan
United Kingdom
China
CRB3 (NM_139161) Human Untagged Clone
CAT＃: SC306121
CRB3 (untagged)-Human crumbs homolog 3 (Drosophila) (CRB3), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_139161 edited
ACCGAGGGTTCGAGGGAGGGACACGGACCAGGAACCTGAGCTAGGTCAAAGACGCCCGGG CCAGGTGCCCCGTCGCAGGTGCCCCTGGCCGGAGATGCGGTAGGAGGGGCGAGCGCGAGA AGCCCCTTCCTCGGCGCTGCCAACCCGCCACCCAGCCCATGGCGAACCCCGGGCTGGGGC TGCTTCTGGCGCTGGGCCTGCCGTTCCTGCTGGCCCGCTGGGGCCGAGCCTGGGGGCAAA TACAGACCACTTCTGCAAATGAGAATAGCACTGTTTTGCCTTCATCCACCAGCTCCAGCT CCGATGGCAACCTGCGTCCRGAAGCCATCACTGCTATCATCGTGGTCTTCTCCCTCTTGG CTGCCTTGCTCCTGGCTGTGGGGCTGGCACTGTTGGTGCGGAAGCTTCGGGAGAAGCGGC AGACGGAGGGCACCTACCGGCCCAGTAGCGAGGAGCAGGTGGGTGCCCGCGTGCCACCGA CCCCCAACCTCAAGTTGCCGCCGGAAGAGCGGCTCATCTGATTCTCCCATGCAGCCGAGG CCCGGGCCCCTCAGGACTCCAAGGAGACGGTGCAGGGCTGCCTGCCCATCTAGGTCCCCT CTCCTGCATCTGTCTCCCTTCATTGCTGTGTGACCTTGGGGAAAGGCAGTGCCCTCTCTG GGCAGTCAGATCCACCCAGTGCTTAATAGCAGGGAAGAAGGTACTTCAAAGACTCTGCCC CTGAGGTCAAGAGAGGATGGGGCTATTCACTTTTATATATTTATATAAAATTAGTAGTGA GATGTAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_139161 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_139161.3, NP_631900.1 |
| RefSeq Size | 1118 bp |
| RefSeq ORF | 363 bp |
| Locus ID | 92359 |
| UniProt ID | Q9BUF7 |
| Protein Families | Transmembrane |
| Protein Pathways | Tight junction |
| Gene Summary | This gene encodes a member of the Crumbs family of proteins. This gene is widely expressed in epithelial tissues where the encoded protein isoforms play various roles such as the control of cytokinesis and ciliogenesis or the formation of tight junctions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223214 | CRB3 (Myc-DDK-tagged)-Human crumbs homolog 3 (Drosophila) (CRB3), transcript variant 2 |
CNY 1,800.00 |
|
| RC223214L3 | Lenti-ORF clone of CRB3 (Myc-DDK-tagged)-Human crumbs homolog 3 (Drosophila) (CRB3), transcript variant 2 |
CNY 5,890.00 |
|
| RC223214L4 | Lenti-ORF clone of CRB3 (mGFP-tagged)-Human crumbs homolog 3 (Drosophila) (CRB3), transcript variant 2 |
CNY 5,890.00 |
|
| RG223214 | CRB3 (tGFP-tagged) - Human crumbs homolog 3 (Drosophila) (CRB3), transcript variant 2 |
CNY 4,370.00 |
