N acetyl transferase 5 (NAA20) (NM_181527) Human Untagged Clone

CAT#: SC307297

NAA20 (untagged)-Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 2



  "NM_181527" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
NAA20 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ1002M8.1; NAT3; NAT3P; NAT5; NAT5P
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_181527, the custom clone sequence may differ by one or more nucleotides
ATGCTGTCTCAGTCATGTAACTTGGATCCACTTACAGAAACTTATGGGATTCCTTTCTAC
CTACAATACCTCGCCCACTGGCCAGAGTATTTCATTGTTGCAGAGGCACCTGGTGGAGAA
TTAATGGGTTATATTATGGGTAAAGCAGAAGGCTCAGTAGCTAGGGAAGAATGGCACGGG
CACGTCACAGCTCTGTCTGTTGCCCCAGAATTTCGACGCCTTGGTTTGGCTGCTAAACTT
ATGGAGTTACTAGAGGAGATTTCAGAAAGAAAGGGTGGATTTTTTGTGGATCTCTTTGTA
AGAGTATCTAACCAAGTTGCAGTTAACATGTACAAGCAGTTGGGCTACAGTGTATATAGG
ACGGTCATAGAGTACTATTCGGCCAGCAACGGGGAGCCTGATGAGGACGCTTATGATATG
AGGAAAGCACTTTCCAGGGATACTGAGAAGAAATCCATCATACCATTACCTCATCCTGTG
AGGCCTGAAGACATTGAATAA
Restriction Sites Please inquire     
ACCN NM_181527
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181527.1, NP_852668.1
RefSeq Size 1346 bp
RefSeq ORF 501 bp
Locus ID 51126
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N(alpha)-terminal acetylation of methionine residues when they are followed by asparagine (Starheim et al., 2008 [PubMed 18570629]).[supplied by OMIM, Apr 2009]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) which is shorter and has a distinct N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...