ENSA (NM_207044) Human Untagged Clone
CAT#: SC308377
ENSA (untagged)-Human endosulfine alpha (ENSA), transcript variant 4
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARPP-19e |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_207044, the custom clone sequence may differ by one or more nucleotides
ATGTCCCAGAAACAAGAAGAAGAGAACCCTGCGGAGGAGACCGGCGAGGAGAAGCAGGAC ACGCAGGAGAAAGAAGGTATTCTGCCTGAGAGAGCTGAAGAGGCAAAGCTAAAGGCCAAA TACCCAAGCCTAGGACAAAAGCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAA GGGCAAAAGTACTTTGACTCAGGAGACTACAACATGGCCAAAGCCAAGATGAAGAATAAG CAGCTGCCAAGTGCAGGACCAGACAAGAACCTGGTGACTGGTGATCACATCCCCACCCCA CAGGATCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTGCGGGGTAA |
Restriction Sites | Please inquire |
ACCN | NM_207044 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_207044.1, NP_996927.1 |
RefSeq Size | 2883 bp |
RefSeq ORF | 354 bp |
Locus ID | 2029 |
UniProt ID | O43768 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein was identified as an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane of pancreatic beta cells and plays a key role in the control of insulin release from pancreatic beta cells. This protein is thought to be an endogenous regulator of KATP channels. In vitro studies have demonstrated that this protein modulates insulin secretion through the interaction with KATP channel, and this gene has been proposed as a candidate gene for type 2 diabetes. At least eight alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4), also known as beta endosulfine, lacks an in-frame exon in the coding region and differs in the 3' end-region compared to variant 1. The resulting isoform (4) lacks an internal region and has a shorter C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209836 | ENSA (Myc-DDK-tagged)-Human endosulfine alpha (ENSA), transcript variant 4 |
CNY 3,990.00 |
|
RC209836L3 | Lenti-ORF clone of ENSA (Myc-DDK-tagged)-Human endosulfine alpha (ENSA), transcript variant 4 |
CNY 5,890.00 |
|
RC209836L4 | Lenti-ORF clone of ENSA (mGFP-tagged)-Human endosulfine alpha (ENSA), transcript variant 4 |
CNY 5,890.00 |
|
RG209836 | ENSA (tGFP-tagged) - Human endosulfine alpha (ENSA), transcript variant 4 |
CNY 4,370.00 |