RFXAP (NM_000538) Human Untagged Clone

CAT#: SC310582

RFXAP (untagged)-Human regulatory factor X-associated protein (RFXAP)



  "NM_000538" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-RFXAP Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310582 representing NM_000538.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGCGCAGGGTGTAGCGGAGGGCGCGGGGCCGGGCGCCGCCAGCGGCGTGCCCCACCCCGCGGCC
CTAGCCCCGGCTGCGGCTCCCACCTTGGCGCCAGCCTCGGTGGCGGCCGCGGCCTCTCAATTCACCCTG
CTAGTGATGCAACCCTGTGCTGGGCAGGACGAGGCTGCGGCCCCCGGGGGCAGCGTTGGGGCGGGCAAG
CCCGTTAGGTACCTGTGCGAAGGGGCCGGGGATGGCGAAGAGGAGGCTGGGGAGGACGAGGCGGACCTG
TTAGACACTTCGGACCCTCCGGGGGGAGGCGAGAGCGCGGCTAGTTTGGAGGATCTAGAGGACGAGGAG
ACTCACTCGGGGGGCGAGGGCAGCAGCGGGGGCGCCCGGAGGCGGGGCAGCGGTGGGGGCAGCATGAGC
AAGACCTGCACCTACGAAGGCTGCAGCGAGACCACGAGCCAGGTGGCCAAGCAGCGCAAACCGTGGATG
TGCAAGAAACACCGCAACAAGATGTACAAGGACAAGTATAAAAAGAAGAAGAGCGACCAGGCCCTGAAC
TGCGGTGGGACTGCCTCGACTGGCAGCGCGGGAAACGTCAAACTCGAGGAAAGTGCAGATAACATACTC
TCCATTGTTAAACAAAGAACAGGATCTTTTGGGGATCGTCCTGCAAGACCTACTCTTTTAGAACAAGTG
TTAAATCAAAAAAGACTGTCGTTACTAAGAAGTCCAGAAGTAGTGCAATTTTTACAGAAACAGCAACAG
CTATTAAATCAGCAAGTTTTGGAGCAAAGACAACAGCAGTTTCCAGGAACATCAATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_000538
Insert Size 819 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000538.3
RefSeq Size 2825 bp
RefSeq ORF 819 bp
Locus ID 5994
UniProt ID O00287
Protein Families Transcription Factors
Protein Pathways Antigen processing and presentation, Primary immunodeficiency
MW 28.2 kDa
Gene Summary Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated ankyrin-containing protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group D. Transcript variants utilizing different polyA signals have been found for this gene. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...