RIP3 (RIPK3) (BC041668) Human Untagged Clone
CAT#: SC312312
(untagged)-Homo sapiens, Similar to receptor-interacting serine-threonine kinase 3, clone MGC:47689 IMAGE:5767146, complete cds
CNY 9,120.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
RIPK3 mouse monoclonal antibody, clone OTI1B3 (formerly 1B3)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RIP3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for BC041668, the custom clone sequence may differ by one or more nucleotides
ATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAA CTGGAGAACCAGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACAT AGGAAGTGGGGCTACGATGTGGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAG GTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCGCCTAGAAGGGGTTATCGAG AAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGACTAAATTCATGGAGAACGGC TCCTTGTCGGGGCTGCTGCAGTCCCAGTGCCCTCGGCCCTGGCCGCTCCTTTGCCGCCTG CTGAAAGAAGTGGTGCTTGGGATGTTTTACCTGCACCGGGACCTCAAGCCATCCAACGTC CTGCTGGACCCAGAGCTGCACGTCAAGGTCAGCTGGTCTACACCCCTCTCAGCCTCAAGA CAAGGCCCCAGAGCTGCTCCAGCCAGGCCCGCCGGACAC |
Restriction Sites | Please inquire |
ACCN | BC041668 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC041668.1 |
RefSeq Size | 2662 bp |
RefSeq ORF | 2662 bp |
Locus ID | 11035 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Cytosolic DNA-sensing pathway |
Gene Summary | The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...