TAS2R46 (NM_176887) Human Untagged Clone

CAT#: SC317464

TAS2R46 (untagged)-Human taste receptor, type 2, member 46 (TAS2R46)



  "NM_176887" in other vectors (5)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms T2R46; T2R54
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_176887 edited
ATGATAACTTTTCTGCCCATCATTTTTTCCATTCTAATAGTGGTTACATTTGTGATTGGA
AATTTTGCTAATGGCTTCATAGCATTGGTAAATTCCATTGAGTGGTTCAAGAGACAAAAG
ATCTCTTTTGCTGACCAAATTCTCACTGCTCTGGCAGTCTCCAGAGTTGGTTTACTCTGG
GTATTAGTATTAAATTGGTATGCAACTGAGTTGAATCCAGCTTTTAACAGTATAGAAGTA
AGAATTACTGCTTACAATGTCTGGGCAGTAATCAACCATTTCAGCAACTGGCTTGCTACT
AGCCTCAGCATATTTTATTTGCTCAAGATTGCCAATTTCTCCAACCTTATTTTTCTTCAC
TTAAAGAGGAGAGTTAAGAGTGTTGTTCTGGTGATACTATTGGGGCCTTTGCTATTTTTG
GTTTGTCATCTTTTTGTGATAAACATGAATCAGATTATATGGACAAAAGAATATGAAGGA
AACATGACTTGGAAGATCAAACTGAGGAGTGCAATGTACCTTTCAAATACAACGGTAACC
ATCCTAGCAAACTTAGTTCCCTTCACTCTGACCCTGATATCTTTTCTGCTGTTAATCTGT
TCTCTGTGTAAACATCTCAAAAAGATGCAGCTCCATGGCAAAGGATCTCAAGATCCCAGC
ATGAAGGTCCACATAAAAGCTATGCAAACTGTGACCTCCTTCCTCTTGTTATGTGCCATT
TACTTTCTGTCCATAATCATGTCAGTTTGGAGTTTTGAGAGTCTGGAAAACAAACCTGTC
TTCATGTTCTGCGAAGCTATTGCATTCAGCTATCCTTCAACCCACCCATTCATCCTGATT
TGGGGAAACAAGAAGCTAAAGCAGACTTTTCTTTCAGTTTTGTGGCATGTGAGGTACTGG
GTGAAAGGAGAGAAGCCTTCATCTTCATAG
Restriction Sites Please inquire     
ACCN NM_176887
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_176887.2, NP_795368.2
RefSeq Size 930 bp
RefSeq ORF 930 bp
Locus ID 259292
UniProt ID P59540
Protein Pathways Taste transduction
Gene Summary TAS2R46 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). For further information on TAS2Rs, see MIM 604791.[supplied by OMIM, Sep 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...