Gemin 7 (GEMIN7) (NM_024707) Human Untagged Clone
CAT#: SC320169
GEMIN7 (untagged)-Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 1
CNY 1,200.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SIP3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_024707.2
GGTCGCCAGCAGGTTCCCTCTCCCCGGCCCCAGCTCTGGACGCTCACCCCAGTGCAACGC
CCTGAGTGACGGAAAGAGGTCTGGCGGCTTCTCTGTTGACAACTCAGCTGGTTCCACACC CTGGCAATTGTGAAGAGTTGGCCAAATGTTTGTCCACTGAGCTGATCTCCTCTCTGGAGC ACCGGGGCCACCAGGAGGGAGCCAAGACAATGCAAACTCCAGTGAACATTCCCGTGCCTG TGCTCCGGCTGCCCCGGGGCCCTGATGGCTTCAGCCGTGGCTTTGCCCCTGATGGACGCA GAGCCCCCTTGAGGCCAGAGGTTCCTGAAATCCAGGAGTGTCCCATAGCTCAAGAATCCC TGGAATCCCAGGAGCAGCGGGCACGAGCCGCCCTTCGGGAGCGTTACCTCCGCAGCCTGC TGGCCATGGTGGGTCATCAGGTGAGCTTCACGTTGCACGAGGGTGTGCGTGTGGCCGCCC ACTTTGGAGCCACCGACCTGGATGTGGCCAACTTCTACGTGTCACAGCTGCAGACTCCCA TAGGTGTGCAAGCAGAGGCGCTGCTCCGATGTAGTGACATTATTTCATATACCTTCAAGC CATAAAGATATTGTGTTCACTTTTCTGCTTGAGGCTAAGGCACTGTATCCCAGGCCTCCC AATGTTCCCGAGCCAGGAACTCTGGGCCCCATGGAGTTATGAGCTCCCTTGGAATTTTGA GCCAAGCTTTAAGCAAGTCTGGACTCCTGAGACCTCCTGGGTCTAGTCAGTAAAATTCTG CAACTCTAGGAATTCTAAGATCCCATTGGAAGGAATGCTCTACCTCACAGAACTCTGAAC CCTACAGAAATATGGGCCTGCTGCCATTTCCTGAAGACCGGGGCATCGGGGTGGGGTGAT AAAGGATACAACCTGCACAGGGGGAAGTTATTAAAGAGGCTGCAAAGTCCAGCCACCCTG AAGATACTCCCCAGTGCTCCCCTCCTGCTAAAGAACCAGTTACCCCAGGAAAAAAAAAAA AAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_024707 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024707.2, NP_078983.1 |
RefSeq Size | 1647 bp |
RefSeq ORF | 396 bp |
Locus ID | 79760 |
UniProt ID | Q9H840 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | The protein encoded by this gene is a component of the core SMN complex, which is required for pre-mRNA splicing in the nucleus. The encoded protein is found in the nucleoplasm, in nuclear "gems" (Gemini of Cajal bodies), and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript. All five variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203184 | GEMIN7 (Myc-DDK-tagged)-Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 1 |
CNY 1,200.00 |
|
RC203184L1 | Lenti ORF clone of Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC203184L2 | Lenti ORF clone of Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC203184L3 | Lenti ORF clone of Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203184L4 | Lenti ORF clone of Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG203184 | GEMIN7 (tGFP-tagged) - Human gem (nuclear organelle) associated protein 7 (GEMIN7), transcript variant 1 |
CNY 2,800.00 |
其它Gemin 7产品