Corticotropin Releasing Factor (CRH) (NM_000756) Human Untagged Clone
CAT#: SC320891
CRH (untagged)-Human corticotropin releasing hormone (CRH)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRF; CRH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_000756.1
GGGAGAAACTCAGAGACCAAGTCCATTGAGAGACTGAGGGGAAAGAGAGGAGAGAAAGAA
AAAGAGAGTGGGAACAGTAAAGAGAAAGGAAGACTACCTCCAGAGAAAGCCCCCGGAGAC GTCTCTCTGCAGAGAGGCGGCAGCACCCGGCTCACCTGCGAAGCGCCTGGGAAGCGAGTG CCCCTAACATGCGGCTGCCGCTGCTTGTGTCCGCGGGAGTCCTGCTGGTGGCTCTCCTGC CCTGCCCGCCATGCAGGGCGCTCCTGAGCCGCGGGCCGGTCCCGGGAGCTCGGCAGGCGC CGCAGCACCCTCAGCCCTTGGATTTCTTCCAGCCGCCGCCGCAGTCCGAGCAGCCCCAGC AGCCGCAGGCTCGGCCGGTCCTGCTCCGCATGGGAGAGGAGTACTTCCTCCGCCTGGGGA ACCTCAACAAGAGCCCGGCCGCTCCCCTTTCGCCCGCCTCCTCGCTCCTCGCCGGCGGCA GCGGCAGCCGCCCTTCGCCGGAACAGGCGACCGCCAACTTTTTCCGCGTGTTGCTGCAGC AGCTGCTGCTGCCTCGGCGCTCGCTCGACAGCCCCGCGGCTCTCGCGGAGCGCGGCGCTA GGAATGCCCTCGGCGGCCACCAGGAGGCACCGGAGAGAGAAAGGCGGTCCGAGGAGCCTC CCATCTCCCTGGATCTCACCTTCCACCTCCTCCGGGAAGTCTTGGAAATGGCCAGGGCCG AGCAGTTAGCACAGCAAGCTCACAGCAACAGGAAACTCATGGAGATTATTGGGAAATAAA ACGGTGCGTTTGGCCAAAAAGAATCTGCATTTAGCACAAAAAAAAATTTAAAAAAATACA GTATTCTGTACCATAGCGCTGCTCTTATGCCATTTGTTTATTTTTATATAGCTTGAAACA TAGAGGGAGAGAGGGAGAGAGCCTATACCCCTTACTTAGCATGCACAAAGTGTATTCACG TGCAGCAGCAACACAATGTTATTCGTTTTGTCTACGTTTAGTTTCCGTTTCCAGGTGTTT ATAGTGGTGTTTTAAAGAGAATGTAGACCTGTGAGAAAACGTTTTGTTTGAAAAAGCAGA CAGAAGTCACTCAATTGTTTTTGTTGTGGTCTGAGCCAAAGAGAATGCCATTCTCTTGGG TGGGTAAGACTAAATCTGTAAGCTCTTTGAAACAACTTTCTCTTGTAAACGTTTCAGTAA TAAAACATCTTTCCAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000756 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000756.1, NP_000747.1 |
RefSeq Size | 1279 bp |
RefSeq ORF | 591 bp |
Locus ID | 1392 |
UniProt ID | P06850 |
Domains | CRF |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Long-term depression |
Gene Summary | This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203144 | CRH (Myc-DDK-tagged)-Human corticotropin releasing hormone (CRH) |
CNY 2,400.00 |
|
RC203144L1 | Lenti ORF clone of Human corticotropin releasing hormone (CRH), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC203144L2 | Lenti ORF clone of Human corticotropin releasing hormone (CRH), mGFP tagged |
CNY 5,890.00 |
|
RC203144L3 | Lenti ORF clone of Human corticotropin releasing hormone (CRH), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203144L4 | Lenti ORF clone of Human corticotropin releasing hormone (CRH), mGFP tagged |
CNY 5,890.00 |
|
RG203144 | CRH (tGFP-tagged) - Human corticotropin releasing hormone (CRH) |
CNY 4,000.00 |
|
SC119702 | CRH (untagged)-Human corticotropin releasing hormone (CRH) |
CNY 2,400.00 |
其它Corticotropin Releasing Factor产品