ASPA (NM_001128085) Human Untagged Clone

CAT#: SC322967

ASPA (untagged)-Human aspartoacylase (ASPA), transcript variant 2



  "NM_001128085" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ASPA mouse monoclonal antibody, clone OTI3G5 (formerly 3G5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACY2; ASP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322967 representing NM_001128085.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTTCTTGTCACATTGCTGAAGAACATATACAAAAGGTTGCTATCTTTGGAGGAACCCATGGGAAT
GAGCTAACCGGAGTATTTCTGGTTAAGCATTGGCTAGAGAATGGCGCTGAGATTCAGAGAACAGGGCTG
GAGGTAAAACCATTTATTACTAACCCCAGAGCAGTGAAGAAGTGTACCAGATATATTGACTGTGACCTG
AATCGCATTTTTGACCTTGAAAATCTTGGCAAAAAAATGTCAGAAGATTTGCCATATGAAGTGAGAAGG
GCTCAAGAAATAAATCATTTATTTGGTCCAAAAGACAGTGAAGATTCCTATGACATTATTTTTGACCTT
CACAACACCACCTCTAACATGGGGTGCACTCTTATTCTTGAGGATTCCAGGAATAACTTTTTAATTCAG
ATGTTTCATTACATTAAGACTTCTCTGGCTCCACTACCCTGCTACGTTTATCTGATTGAGCATCCTTCC
CTCAAATATGCGACCACTCGTTCCATAGCCAAGTATCCTGTGGGTATAGAAGTTGGTCCTCAGCCTCAA
GGGGTTCTGAGAGCTGATATCTTGGATCAAATGAGAAAAATGATTAAACATGCTCTTGATTTTATACAT
CATTTCAATGAAGGAAAAGAATTTCCTCCCTGCGCCATTGAGGTCTATAAAATTATAGAGAAAGTTGAT
TACCCCCGGGATGAAAATGGAGAAATTGCTGCTATCATCCATCCTAATCTGCAGGATCAAGACTGGAAA
CCACTGCATCCTGGGGATCCCATGTTTTTAACTCTTGATGGGAAGACGATCCCACTGGGCGGAGACTGT
ACCGTGTACCCCGTGTTTGTGAATGAGGCCGCATATTACGAAAAGAAAGAAGCTTTTGCAAAGACAACT
AAACTAACGCTCAATGCAAAAAGTATTCGCTGCTGTTTACATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001128085
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001128085.1
RefSeq Size 1368 bp
RefSeq ORF 942 bp
Locus ID 443
UniProt ID P45381
Protein Families Druggable Genome
Protein Pathways Alanine, aspartate and glutamate metabolism, Histidine metabolism
MW 35.7 kDa
Gene Summary This gene encodes an enzyme that catalyzes the conversion of N-acetyl_L-aspartic acid (NAA) to aspartate and acetate. NAA is abundant in the brain where hydrolysis by aspartoacylase is thought to help maintain white matter. This protein is an NAA scavenger in other tissues. Mutations in this gene cause Canavan disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an alternate 5' UTR and encodes the same protein, as compared to variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...