CD244 (NM_001166664) Human Untagged Clone

CAT#: SC328444

CD244 (untagged)-Human CD244 molecule natural killer cell receptor 2B4 (CD244) transcript variant 3



  "NM_001166664" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CD244 mouse monoclonal antibody,clone OTI1B12
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2B4; NAIL; NKR2B4; Nmrk; SLAMF4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328444 representing NM_001166664.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGGGCAAGTGGTCACCCTCATACTCCTCCTGCTCCTCAAGGTGTATCAGGGCAAAGGATGCCAG
GGATCAGCTGACCATGTGGTTAGCATCTCGGGAGTGCCTCTTCAGTTACAACCAAACAGCATACAGACG
AAGGTTGACAGCATTGCATGGAAGAAGTTGCTGCCCTCACAAAATGGATTTCATCACATATTGAAGTGG
GAGAATGGCTCTTTGCCTTCCAATACTTCCAATGATAGATTCAGTTTTATAGTCAAGAACTTGAGTCTT
CTCATCAAGGCAGCTCAGCAGCAGGACAGTGGCCTCTACTGCCTGGAGGTCACCAGTATATCTGGAAAA
GTTCAGACAGCCACGTTCCAGGTTTTTGTATTTGAATTCAGATTTTGGCCGTTTTTGGTGATCATCGTG
ATTCTAAGCGCACTGTTCCTTGGCACCCTTGCCTGCTTCTGTGTGTGGAGGAGAAAGAGGAAGGAGAAG
CAGTCAGAGACCAGTCCCAAGGAATTTTTGACAATTTACGAAGATGTCAAGGATCTGAAAACCAGGAGA
AATCACGAGCAGGAGCAGACTTTTCCTGGAGGGGGGAGCACCATCTACTCTATGATCCAGTCCCAGTCT
TCTGCTCCCACGTCACAAGAACCTGCATATACATTATATTCATTAATTCAGCCTTCCAGGAAGTCTGGA
TCCAGGAAGAGGAACCACAGCCCTTCCTTCAATAGCACTATCTATGAAGTGATTGGAAAGAGTCAACCT
AAAGCCCAGAACCCTGCTCGATTGAGCCGCAAAGAGCTGGAGAACTTTGATGTTTATTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166664
Insert Size 822 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166664.1
RefSeq Size 2252 bp
RefSeq ORF 822 bp
Locus ID 51744
UniProt ID Q9BZW8
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
MW 30.8 kDa
Gene Summary This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Transcript Variant: This variant (3) is lacking an in-frame coding exon compared to variant 1, resulting in a shorter isoform (3) missing an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...