CHST11 (NM_001173982) Human Untagged Clone

CAT#: SC328560

CHST11 (untagged)-Human carbohydrate (chondroitin 4) sulfotransferase 11 (CHST11) transcript variant 2



  "NM_001173982" in other vectors (4)

CNY 5,610.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CHST11 rabbit polyclonal antibody
    • 100 ul

CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C4ST; C4ST-1; C4ST1; HSA269537; OCBMD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328560 representing NM_001173982.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCCAGCGCTGCTGGAAGTGATGAGGATGAACAGAATCTGCCGGATGGTGCTGGCCACTTGCTTG
GGATCCTTTATCCTGGTCATCTTCTATTTCCAAATCATGCGGAGGAATCCCTTTGGTGTGGACATCTGC
TGCCGGAAGGGGTCCCGAAGCCCCCTGCAGGAACTCTACAACCCAATCCAGCTGGAGCTCTCAAACACT
GCTGTCCTGCACCAGATGCGGCGGGACCAGGTGACAGACACGTGCCGAGCCAACAGCGCCACAAGCCGT
AAGCGGAGGGTGCTGACCCCCAACGACCTGAAGCACTTGGTGGTGGATGAGGACCACGAGCTCATCTAC
TGCTACGTGCCCAAGGTGGCCTGCACCAACTGGAAGCGGCTCATGATGGTCCTGACCGGGCGGGGGAAG
TACAGCGACCCCATGGAGATCCCGGCCAACGAGGCACACGTCTCCGCCAACCTGAAGACCCTGAACCAG
TACAGCATCCCAGAAATCAACCACCGCTTGAAAAGCTACATGAAGTTCCTGTTTGTCCGGGAGCCCTTC
GAGAGGCTAGTGTCCGCCTACCGCAACAAGTTCACCCAGAAGTACAACATCTCCTTCCACAAGCGGTAC
GGCACCAAGATCATCAAACGCCAGCGGAAGAACGCCACCCAGGAGGCCCTGCGCAAAGGGGACGATGTC
AAATTCGAGGAGTTTGTGGCCTATCTCATCGACCCACACACCCAGCGGGAGGAGCCTTTCAACGAACAC
TGGCAAACCGTCTACTCACTCTGCCATCCCTGCCACATCCACTATGACCTCGTGGGCAAGTACGAGACA
CTGGAAGAGGATTCTAATTACGTCCTGCAGCTGGCAGGAGTGGGCAGCTACCTGAAGTTCCCCACCTAT
GCAAAGTCTACGAGAACTACTGATGAAATGACCACAGAATTCTTCCAGAACATCAGCTCAGAGCACCAA
ACGCAGCTGTACGAAGTCTACAAACTCGATTTTTTAATGTTCAATTACTCAGTGCCAAGCTACCTGAAA
TTGGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001173982
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001173982.1
RefSeq Size 5753 bp
RefSeq ORF 1044 bp
Locus ID 50515
UniProt ID Q9NPF2
Protein Families Transmembrane
Protein Pathways Chondroitin sulfate biosynthesis, Sulfur metabolism
MW 41 kDa
Gene Summary The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving this gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) uses an alternate in-frame donor splice site at the 5' terminal exon compared to variant 1. This results in a shorter isoform (2) missing a 5 aa protein segment near the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...