Geminin (GMNN) (NM_001251990) Human Untagged Clone

CAT#: SC330256

GMNN (untagged) - Homo sapiens geminin, DNA replication inhibitor (GMNN), transcript variant 3



  "NM_001251990" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-GMNN Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Gem; MGORS6
Vector pCMV6-Entry
Sequence Data
>SC330256 representing NM_001251990.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATCCCAGTATGAAGCAGAAACAAGAAGAAATCAAAGAGAATATAAAGAATAGTTCTGTCCCAAGA
AGAACTCTGAAGATGATTCAGCCTTCTGCATCTGGATCTCTTGTTGGAAGAGAAAATGAGCTGTCCGCA
GGCTTGTCCAAAAGGAAACATCGGAATGACCACTTAACATCTACAACTTCCAGCCCTGGGGTTATTGTC
CCAGAATCTAGTGAAAATAAAAATCTTGGAGGAGTCACCCAGGAGTCATTTGATCTTATGATTAAAGAA
AATCCATCCTCTCAGTATTGGAAGGAAGTGGCAGAAAAACGGAGAAAGGCGCTGTATGAAGCACTTAAG
GAAAATGAGAAACTTCATAAAGAAATTGAACAAAAGGACAATGAAATTGCCCGCCTGAAAAAGGAGAAT
AAAGAACTGGCAGAAGTAGCAGAACATGTACAGTATATGGCAGAGCTAATAGAGAGACTGAATGGTGAA
CCTCTGGATAATTTTGAATCACTGGATAATCAGGAATTTGATTCTGAAGAAGAAACTGTTGAGGATTCT
CTAGTGGAAGACTCAGAAATTGGCACGTGTGCTGAAGGAACTGTATCTTCCTCTACGGATGCAAAGCCA
TGTATATGA

Restriction Sites SgfI-MluI     
ACCN NM_001251990
Insert Size 630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001251990.1
RefSeq Size 1067 bp
RefSeq ORF 630 bp
Locus ID 51053
UniProt ID O75496
Protein Families Druggable Genome, Stem cell - Pluripotency
MW 23.6 kDa
Gene Summary This gene encodes a protein that plays a critical role in cell cycle regulation. The encoded protein inhibits DNA replication by binding to DNA replication factor Cdt1, preventing the incorporation of minichromosome maintenance proteins into the pre-replication complex. The encoded protein is expressed during the S and G2 phases of the cell cycle and is degraded by the anaphase-promoting complex during the metaphase-anaphase transition. Increased expression of this gene may play a role in several malignancies including colon, rectal and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and two pseudogenes of this gene are located on the short arm of chromosome 16. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...