KCNJ15 (NM_001276435) Human Untagged Clone

CAT#: SC331055

KCNJ15 (untagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 4



  "NM_001276435" in other vectors (2)

CNY 3,610.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
KCNJ15 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IRKK; KIR1.3; KIR4.2
Vector pCMV6-Entry
Sequence Data
>SC331055 representing NM_001276435.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATGCCATTCACATCGGCATGTCCAGCACCCCCCTGGTGAAGCACACTGCTGGGGCTGGGCTCAAG
GCCAACAGACCCCGCGTCATGTCCAAGAGTGGGCACAGCAACGTGAGAATTGACAAAGTGGATGGCATA
TACCTACTCTACCTGCAAGACCTGTGGACCACAGTTATCGACATGAAGTGGAGATACAAACTCACCCTG
TTCGCTGCCACTTTTGTGATGACCTGGTTCCTTTTTGGAGTCATCTACTATGCCATCGCGTTTATTCAT
GGGGACTTAGAACCCGGTGAGCCCATTTCAAATCATACCCCCTGCATCATGAAAGTGGACTCTCTCACT
GGGGCGTTTCTCTTTTCCCTGGAATCCCAGACAACCATTGGCTATGGAGTCCGTTCCATCACAGAGGAA
TGTCCTCATGCCATCTTCCTGTTGGTTGCTCAGTTGGTCATCACGACCTTGATTGAGATCTTCATCACC
GGAACCTTCCTGGCCAAAATCGCCAGACCCAAAAAGCGGGCTGAGACCATCAAGTTCAGCCACTGTGCA
GTCATCACCAAGCAGAATGGGAAGCTGTGCTTGGTGATTCAGGTAGCCAATATGAGGAAGAGCCTCTTG
ATTCAGTGCCAGCTCTCTGGCAAGCTCCTGCAGACCCACGTCACCAAGGAGGGGGAGCGGATTCTCCTC
AACCAAGCCACTGTCAAATTCCACGTGGACTCCTCCTCTGAGAGCCCCTTCCTCATTCTGCCCATGACA
TTCTACCATGTGCTGGATGAGACGAGCCCCCTGAGAGACCTCACACCCCAAAACCTAAAGGAGAAGGAG
TTTGAGCTTGTGGTCCTCCTCAATGCCACTGTGGAATCCACCAGCGCTGTCTGCCAGAGCCGAACATCT
TATATCCCAGAGGAAATCTACTGGGGTTTTGAGTTTGTGCCTGTGGTATCTCTCTCCAAAAATGGAAAA
TATGTGGCTGATTTCAGTCAGTTTGAACAGATTCGGAAAAGCCCAGATTGCACATTTTACTGTGCAGAT
TCTGAGAAACAGCAACTCGAGGAGAAGTACAGGCAGGAGGATCAGAGGGAAAGAGAACTGAGGACACTT
TTATTACAACAGAGCAATGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001276435
Insert Size 1128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276435.1
RefSeq Size 3081 bp
RefSeq ORF 1128 bp
Locus ID 3772
UniProt ID Q99712
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
MW 42.6 kDa
Gene Summary Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
Transcript Variant: This variant (4) uses an alternate splice junction and contains two additional exons in the 5' UTR compared to variant 1. All eight variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...