Proteasome subunit beta type 2 (PSMB2) (NM_001199779) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	HC7-I
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331361 representing NM_001199779. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGTACCTCATCGATCATGACAAGATGTTTAAGATGAGTGAAAAGATATTACTCCTGTGTGTTGGA GAGGCTGGAGACACTGTACAGTTTGCAGAATATATTCAGAAAAACGTGCAACTTTATAAGATGCGAAAT GGATATGAATTGTCTCCCACGGCAGCAGCTAACTTCACACGCCGAAACCTGGCTGACTGTCTTCGGAGT CGGACCCCATATCATGTGAACCTCCTCCTGGCTGGCTATGATGAGCATGAAGGGCCAGCGCTGTATTAC ATGGACTACCTGGCAGCCTTGGCCAAGGCCCCTTTTGCAGCCCACGGCTATGGTGCCTTCCTGACTCTC AGTATCCTCGACCGATACTACACACCGACTATCTCACGTGAGAGGGCAGTGGAACTCCTTAGGAAATGT CTGGAGGAGCTCCAGAAACGCTTCATCCTGAATCTGCCAACCTTCAGTGTTCGAATCATTGACAAAAAT GGCATCCATGACCTGGATAACATTTCCTTCCCCAAACAGGGCTCCTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001199779
Insert Size	531 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001199779.1
RefSeq Size	4391 bp
RefSeq ORF	531 bp
Locus ID	5690
Protein Families	Druggable Genome, Protease
Protein Pathways	Proteasome
MW	20.2 kDa
Gene Summary	The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) lacks an in-frame segment in the 5' region, as compared to variant 1. The resulting isoform (2) lacks an internal segment in the N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.