Proteasome subunit beta type 2 (PSMB2) (NM_001199779) Human Untagged Clone
CAT#: SC331361
PSMB2 (untagged) - Homo sapiens proteasome (prosome, macropain) subunit, beta type, 2 (PSMB2), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HC7-I |
Vector | pCMV6-Entry |
Sequence Data |
>SC331361 representing NM_001199779.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGTACCTCATCGATCATGACAAGATGTTTAAGATGAGTGAAAAGATATTACTCCTGTGTGTTGGA GAGGCTGGAGACACTGTACAGTTTGCAGAATATATTCAGAAAAACGTGCAACTTTATAAGATGCGAAAT GGATATGAATTGTCTCCCACGGCAGCAGCTAACTTCACACGCCGAAACCTGGCTGACTGTCTTCGGAGT CGGACCCCATATCATGTGAACCTCCTCCTGGCTGGCTATGATGAGCATGAAGGGCCAGCGCTGTATTAC ATGGACTACCTGGCAGCCTTGGCCAAGGCCCCTTTTGCAGCCCACGGCTATGGTGCCTTCCTGACTCTC AGTATCCTCGACCGATACTACACACCGACTATCTCACGTGAGAGGGCAGTGGAACTCCTTAGGAAATGT CTGGAGGAGCTCCAGAAACGCTTCATCCTGAATCTGCCAACCTTCAGTGTTCGAATCATTGACAAAAAT GGCATCCATGACCTGGATAACATTTCCTTCCCCAAACAGGGCTCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199779 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199779.1 |
RefSeq Size | 4391 bp |
RefSeq ORF | 531 bp |
Locus ID | 5690 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Proteasome |
MW | 20.2 kDa |
Gene Summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) lacks an in-frame segment in the 5' region, as compared to variant 1. The resulting isoform (2) lacks an internal segment in the N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233363 | PSMB2 (Myc-DDK tagged) - Homo sapiens proteasome (prosome, macropain) subunit, beta type, 2 (PSMB2), transcript variant 2 |
CNY 3,990.00 |
|
RG233363 | PSMB2 (tGFP-tagged) - Homo sapiens proteasome (prosome, macropain) subunit, beta type, 2 (PSMB2), transcript variant 2 |
CNY 4,370.00 |
其它Proteasome subunit beta type 2产品