FLAP (ALOX5AP) (NM_001204406) Human Untagged Clone
CAT#: SC331572
ALOX5AP (untagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2
CNY 2,640.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FLAP |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001204406, the custom clone sequence may differ by one or more nucleotides
ATGCTCACATTTAATCACGATGCTCCCTGGCATACACAGAAGACTCTGAAAACTTCTGAATTTGGGAAAT CCTTTGGCACCTTGGGGCACATTGGGAACATAAGCCATCAGTGCTGGGCAGGTTGTGCAGCTGGAGGCAG AGCAGTCCTCTCTGGGGAGCCTGAAGCAAACATGGATCAAGAAACTGTAGGCAATGTTGTCCTGTTGGCC ATCGTCACCCTCATCAGCGTGGTCCAGAATGGATTCTTTGCCCATAAAGTGGAGCACGAAAGCAGGACCC AGAATGGGAGGAGCTTCCAGAGGACCGGAACACTTGCCTTTGAGCGGGTCTACACTGCCAACCAGAACTG TGTAGATGCGTACCCCACTTTCCTCGCTGTGCTCTGGTCTGCGGGGCTACTTTGCAGCCAAGTTCCTGCT GCGTTTGCTGGACTGATGTACTTGTTTGTGAGGCAAAAGTACTTTGTCGGTTACCTAGGAGAGAGAACGC AGAGCACCCCTGGCTACATATTTGGGAAACGCATCATACTCTTCCTGTTCCTCATGTCCGTTGCTGGCAT ATTCAACTATTACCTCATCTTCTTTTTCGGAAGTGACTTTGAAAACTACATAAAGACGATCTCCACCACC ATCTCCCCTCTACTTCTCATTCCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204406 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001204406.1, NP_001191335.1 |
RefSeq Size | 1242 bp |
RefSeq ORF | 657 bp |
Locus ID | 241 |
UniProt ID | P20292 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a protein which, with 5-lipoxygenase, is required for leukotriene synthesis. Leukotrienes are arachidonic acid metabolites which have been implicated in various types of inflammatory responses, including asthma, arthritis and psoriasis. This protein localizes to the plasma membrane. Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit 5-lipoxygenase activation. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (2) has an alternate 5' sequence which includes an upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) is longer at the N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233468 | ALOX5AP (Myc-DDK tagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2 |
CNY 3,600.00 |
|
RG233468 | ALOX5AP (tGFP-tagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2 |
CNY 5,200.00 |