FLAP (ALOX5AP) (NM_001204406) Human Untagged Clone

CAT#: SC331572

ALOX5AP (untagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2



  "NM_001204406" in other vectors (2)

CNY 2,640.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Polyclonal Antibody against FLAP / ALOX5AP (internal)
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FLAP
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001204406, the custom clone sequence may differ by one or more nucleotides


ATGCTCACATTTAATCACGATGCTCCCTGGCATACACAGAAGACTCTGAAAACTTCTGAATTTGGGAAAT
CCTTTGGCACCTTGGGGCACATTGGGAACATAAGCCATCAGTGCTGGGCAGGTTGTGCAGCTGGAGGCAG
AGCAGTCCTCTCTGGGGAGCCTGAAGCAAACATGGATCAAGAAACTGTAGGCAATGTTGTCCTGTTGGCC
ATCGTCACCCTCATCAGCGTGGTCCAGAATGGATTCTTTGCCCATAAAGTGGAGCACGAAAGCAGGACCC
AGAATGGGAGGAGCTTCCAGAGGACCGGAACACTTGCCTTTGAGCGGGTCTACACTGCCAACCAGAACTG
TGTAGATGCGTACCCCACTTTCCTCGCTGTGCTCTGGTCTGCGGGGCTACTTTGCAGCCAAGTTCCTGCT
GCGTTTGCTGGACTGATGTACTTGTTTGTGAGGCAAAAGTACTTTGTCGGTTACCTAGGAGAGAGAACGC
AGAGCACCCCTGGCTACATATTTGGGAAACGCATCATACTCTTCCTGTTCCTCATGTCCGTTGCTGGCAT
ATTCAACTATTACCTCATCTTCTTTTTCGGAAGTGACTTTGAAAACTACATAAAGACGATCTCCACCACC
ATCTCCCCTCTACTTCTCATTCCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001204406
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204406.1, NP_001191335.1
RefSeq Size 1242 bp
RefSeq ORF 657 bp
Locus ID 241
UniProt ID P20292
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a protein which, with 5-lipoxygenase, is required for leukotriene synthesis. Leukotrienes are arachidonic acid metabolites which have been implicated in various types of inflammatory responses, including asthma, arthritis and psoriasis. This protein localizes to the plasma membrane. Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit 5-lipoxygenase activation. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) has an alternate 5' sequence which includes an upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) is longer at the N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...