GLT28D1 (ALG13) (NM_001257239) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CDG1S; CXorf45; DEE36; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333319 representing NM_001257239. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACAATCATCAGCTGGAACTGGCAAAGCAGCTACACAAAGAGGGTCATCTCTTCTATTGTACCTGC AGCACGCTTCCTGGGCTGTTACAGTCAATGGACTTATCAACACTGAAATGTTATCCTCCTGGCCAGCCA GAAAAATTTTCTGCATTTTTGGATAAAGTTGTTGGATTACAAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001257239
Insert Size	186 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001257239.2
RefSeq Size	1386 bp
RefSeq ORF	186 bp
Locus ID	79868
Protein Pathways	Metabolic pathways, N-Glycan biosynthesis
MW	6.9 kDa
Gene Summary	The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (11) has multiple differences, compared to variant 1, including the use of a downstream, in-frame start codon and alternate 3' UTR. Variants 9, 11 and 12 encode the same isoform (7) which is significantly shorter and has a unique C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.