PHPT1 (NM_001287343) Human Untagged Clone

CAT#: SC333726

PHPT1 (untagged) - Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 5



  "NM_001287343" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PHPT1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333726 representing NM_001287343.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGACATCGACTCCGACGGCGTCTTCAAGTATGTG
CTGATCCGAGTCCACTCGGCTCCCCGCTCCGGGGCTCCGGCTGCAGAGAGCAAGGAGATCGTGCGCGGC
TACAAGTGGGCTGAGTACCATGCGGACATCTACGACAAAGTGTCGGGCGACATGCAGAAGCAAGGCTGC
GACTGTGAGTGTCTGGGCGGCGGGCGCATCTCCCACCAGAGTCAGGACAAGAAGATTCACGTGTACGGC
TATTCCATGCAGATGAGACCCACGTGCGTCCCTCTGGGCGCCTCAGGCCCCAGGATCCACCATCAAGGC
CTATGGTCCTGCCCAGCACGCCATTTCAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001287343
Insert Size 378 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287343.1
RefSeq Size 1257 bp
RefSeq ORF 378 bp
Locus ID 29085
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism
MW 13.8 kDa
Gene Summary This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region and includes an alternate exon in the 3' coding region, compared to variant 4. This results in a frameshift and an early stop codon. It encodes isoform 5, which is shorter and has a distinct C-terminus, compared to isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...