Uridine Phosphorylase 1 (UPP1) (NM_001287430) Human Untagged Clone

CAT#: SC334167

UPP1 (untagged) - Human uridine phosphorylase 1 (UPP1), transcript variant 6



  "NM_001287430" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-UPP1 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UDRPASE; UP; UPASE; UPP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287430, the custom clone sequence may differ by one or more nucleotides


ATGCAGAGAAAGCTGAAAGTCACAAGTCTGGAGCCCGGCACTGTGGTCATAACAGAGCAGGCAGTGGATA
CCTGCTTCAAGGCAGAGTTTGAGCAGATTGTCCTGGGGAAGCGGGTCATCCGGAAAACGGACCTTAACAA
GAAGCTGGTGCAGGAGCTGTTGCTGTGTTCTGCAGAGCTGAGCGAGTTCACCACAGTGGTGGGGAACACC
ATGTGCACCTTGGACTTCTATGAAGGGCAAGGCCGTCTGGATGGGGCTCTCTGCTCCTACACGGAGAAGG
ACAAGCAGGCGTATCTGGAGGCAGCCTATGCAGCCGGCGTCCGCAATATCGAGATGGAGTCCTCGGTGTT
TGCCGCCATGTGCAGCGCCTGCGGCCTCCAAGCGGCCGTGGTGTGTGTCACCCTCCTGAACCGCCTGGAA
GGGGACCAGATCAGCAGCCCTCGCAATGTGCTCAGCGAGTACCAGCAGAGGCCGCAGCGGCTGGTGAGCT
ACTTCATCAAGAAGAAACTGAGCAAGGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287430
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287430.1, NP_001274359.1
RefSeq Size 1237 bp
RefSeq ORF 522 bp
Locus ID 7378
UniProt ID Q16831
Protein Pathways Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
Gene Summary This gene encodes a uridine phosphorylase, an enzyme that catalyzes the reversible phosphorylation of uridine (or 2'- deoxyuridine) to uracil and ribose-1-phosphate (or deoxyribose-1-phosphate). The encoded enzyme functions in the degradation and salvage of pyrimidine ribonucleosides. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks three exons in the 5' coding region and initiates translation at an alternate start codon, compared to variant 8. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Variants 4, 5 and 6 all encode isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...