FPGT (NM_001199329) Human Untagged Clone
CAT#: SC334245
FPGT (untagged) - Human fucose-1-phosphate guanylyltransferase (FPGT), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GFPP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001199329, the custom clone sequence may differ by one or more nucleotides
ATGCGTGCTGTGCGGCGCGGTCTCAGGGAAGGTGGGGCTATGGCAGCTGCTAGGGACCCTCCGGAAGTAT CGCTGCGAGAAGCCACCCAGCGAAAATTGCGGAGGTTTTCCGAGCTAAGAGGCAAACTTGTAGCACGTGG AGAATTCTGGGACATAGTTGCAATAACAGCGGCTGATGAAAAACAGGAACTTGCTTACAACCAACAGCTG TCAGAAAAGCTGAAAAGAAAGGAGTTACCCCTTGGAGTTCAATATCACGTTTTTGTGGATCCTGCTGGAG CCAAAATTGGAAATGGAGGATCAACACTTTGTGCCCTTCAATGTTTGGAAAAGCTATATGGAGATAAATG GAATTCTTTTACCATCTTATTAATTCACTCTGTATCTTTCCAGATATACCAGAATGCTCTGGCAAAACAT CCTGTATCATTCAAAGCATACTGGATTCAAGATGTTCTGTGGCACCTGGCTCAGTTGTGGAGTATTCCAG ATTGGGGCCTGATGTTTCAGTTGGGGAAAACTGCATTATTAGTGGTTCTTACATCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199329 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199329.2, NP_001186258.2 |
RefSeq Size | 3905 bp |
RefSeq ORF | 549 bp |
Locus ID | 8790 |
UniProt ID | O14772 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Fructose and mannose metabolism, Metabolic pathways |
Gene Summary | L-fucose is a key sugar in glycoproteins and other complex carbohydrates since it may be involved in many of the functional roles of these macromolecules, such as in cell-cell recognition. The fucosyl donor for these fucosylated oligosaccharides is GDP-beta-L-fucose. There are two alternate pathways for the biosynthesis of GDP-fucose; the major pathway converts GDP-alpha-D-mannose to GDP-beta-L-fucose. The protein encoded by this gene participates in an alternate pathway that is present in certain mammalian tissues, such as liver and kidney, and appears to function as a salvage pathway to reutilize L-fucose arising from the turnover of glycoproteins and glycolipids. This pathway involves the phosphorylation of L-fucose to form beta-L-fucose-1-phosphate, and then condensation of the beta-L-fucose-1-phosphate with GTP by fucose-1-phosphate guanylyltransferase to form GDP-beta-L-fucose. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream TNNI3 interacting kinase (TNNI3K) gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...