Adenosine Receptor A2a (ADORA2A) (NM_001278497) Human Untagged Clone

CAT#: SC335957

ADORA2A (untagged) - Human adenosine A2a receptor (ADORA2A), transcript variant 1



  "NM_001278497" in other vectors (2)

CNY 5,856.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
ADORA2A rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A2aR; ADORA2; RDC8
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278497, the custom clone sequence may differ by one or more nucleotides


ATGCCCATCATGGGCTCCTCGGTGTACATCACGGTGGAGCTGGCCATTGCTGTGCTGGCCATCCTGGGCA
ATGTGCTGGTGTGCTGGGCCGTGTGGCTCAACAGCAACCTGCAGAACGTCACCAACTACTTTGTGGTGTC
ACTGGCGGCGGCCGACATCGCAGTGGGTGTGCTCGCCATCCCCTTTGCCATCACCATCAGCACCGGGTTC
TGCGCTGCCTGCCACGGCTGCCTCTTCATTGCCTGCTTCGTCCTGGTCCTCACGCAGAGCTCCATCTTCA
GTCTCCTGGCCATCGCCATTGACCGCTACATTGCCATCCGCATCCCGCTCCGGTACAATGGCTTGGTGAC
CGGCACGAGGGCTAAGGGCATCATTGCCATCTGCTGGGTGCTGTCGTTTGCCATCGGCCTGACTCCCATG
CTAGGTTGGAACAACTGCGGTCAGCCAAAGGAGGGCAAGAACCACTCCCAGGGCTGCGGGGAGGGCCAAG
TGGCCTGTCTCTTTGAGGATGTGGTCCCCATGAACTACATGGTGTACTTCAACTTCTTTGCCTGTGTGCT
GGTGCCCCTGCTGCTCATGCTGGGTGTCTATTTGCGGATCTTCCTGGCGGCGCGACGACAGCTGAAGCAG
ATGGAGAGCCAGCCTCTGCCGGGGGAGCGGGCACGGTCCACACTGCAGAAGGAGGTCCATGCTGCCAAGT
CACTGGCCATCATTGTGGGGCTCTTTGCCCTCTGCTGGCTGCCCCTACACATCATCAACTGCTTCACTTT
CTTCTGCCCCGACTGCAGCCACGCCCCTCTCTGGCTCATGTACCTGGCCATCGTCCTCTCCCACACCAAT
TCGGTTGTGAATCCCTTCATCTACGCCTACCGTATCCGCGAGTTCCGCCAGACCTTCCGCAAGATCATTC
GCAGCCACGTCCTGAGGCAGCAAGAACCTTTCAAGGCAGCTGGCACCAGTGCCCGGGTCTTGGCAGCTCA
TGGCAGTGACGGAGAGCAGGTCAGCCTCCGTCTCAACGGCCACCCGCCAGGAGTGTGGGCCAACGGCAGT
GCTCCCCACCCTGAGCGGAGGCCCAATGGCTATGCCCTGGGGCTGGTGAGTGGAGGGAGTGCCCAAGAGT
CCCAGGGGAACACGGGCCTCCCAGACGTGGAGCTCCTTAGCCATGAGCTCAAGGGAGTGTGCCCAGAGCC
CCCTGGCCTAGATGACCCCCTGGCCCAGGATGGAGCAGGAGTGTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278497
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278497.1, NP_001265426.1
RefSeq Size 2754 bp
RefSeq ORF 1239 bp
Locus ID 135
UniProt ID P29274
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction
Gene Summary This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (1) represents the longest transcript. Variants, 1, 2, 3, 4, and 5 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...