Isocitrate dehydrogenase (IDH1) (NM_001282387) Human Untagged Clone

CAT#: SC335983

IDH1 (untagged) - Human isocitrate dehydrogenase 1 (NADP+), soluble (IDH1), transcript variant 3



  "NM_001282387" in other vectors (2)

CNY 3,900.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-IDH1 (Isocitrate Dehydrogenase 1) mouse monoclonal antibody, clone OTI2H9 (formerly 2H9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC; PICD
Vector pCMV6-Entry
Sequence Data
>SC335983 representing NM_001282387.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCAAAAAAATCAGTGGCGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGG
GAATTGATTAAAGAGAAACTCATTTTTCCCTACGTGGAATTGGATCTACATAGCTATGATTTAGGCATA
GAGAATCGTGATGCCACCAACGACCAAGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGCATAATGTT
GGCGTCAAATGTGCCACTATCACTCCTGATGAGAAGAGGGTTGAGGAGTTCAAGTTGAAACAAATGTGG
AAATCACCAAATGGCACCATACGAAATATTCTGGGTGGCACGGTCTTCAGAGAAGCCATTATCTGCAAA
AATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCTATCATCATAGGTCGTCATGCTTATGGGGATCAA
TACAGAGCAACTGATTTTGTTGTTCCTGGGCCTGGAAAAGTAGAGATAACCTACACACCAAGTGACGGA
ACCCAAAAGGTGACATACCTGGTACATAACTTTGAAGAAGGTGGTGGTGTTGCCATGGGGATGTATAAT
CAAGATAAGTCAATTGAAGATTTTGCACACAGTTCCTTCCAAATGGCTCTGTCTAAGGGTTGGCCTTTG
TATCTGAGCACCAAAAACACTATTCTGAAGAAATATGATGGGCGTTTTAAAGACATCTTTCAGGAGATA
TATGACAAGCAGTACAAGTCCCAGTTTGAAGCTCAAAAGATCTGGTATGAGCATAGGCTCATCGACGAC
ATGGTGGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTG
CAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGAT
GGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGA
CAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAG
CTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAG
GCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGACTAC
TTGAATACATTTGAGTTCATGGATAAACTTGGAGAAAACTTGAAGATCAAACTAGCTCAGGCCAAACTT
TAA

Restriction Sites SgfI-MluI     
ACCN NM_001282387
Insert Size 1245 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282387.1
RefSeq Size 2470 bp
RefSeq ORF 1245 bp
Locus ID 3417
UniProt ID O75874
Protein Pathways Citrate cycle (TCA cycle), Glutathione metabolism, Metabolic pathways
MW 46.7 kDa
Gene Summary Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) has an alternate 5' UTR exon, compared to variant 1. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...