EZH2 Human qPCR Primer Pair (NM_004456)
CNY 1,140.00
Cited in 3 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
CNY 8,248.00
CNY 2,710.00
CNY 5,800.00
CNY 5,176.00
CNY 5,800.00
CNY 5,800.00
CNY 5,800.00
Specifications
Product Data | |
Gene ID | 2146 |
Forward Sequence | GACCTCTGTCTTACTTGTGGAGC |
Reverse Sequence | CGTCAGATGGTGCCAGCAATAG |
Synonyms | ENX-1; ENX1; EZH2b; KMT6; KMT6A; WVS; WVS2 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
EZH1 repression generates mature iPSC-derived CAR T cells with enhanced antitumor activity.
,null,
Cell stem cell
,PubMed ID 35931029
[EZH2]
|
Epigenetic Role of Histone Lysine Methyltransferase and Demethylase on the Expression of Transcription Factors Associated with the Epithelial-to-Mesenchymal Transition of Lung Adenocarcinoma Metastasis to the Brain
,Lee, YM;Kim, SH;Kim, MS;Kim, DC;Lee, EH;Lee, JS;Lee, SH;Kim, YZ;,
Cancers
,PubMed ID 33291558
[EZH2]
|
The polycomb group protein EZH2 inhibits lung cancer cell growth by repressing the transcription factor Nrf2
,Li, Z;Xu, L;Tang, N;Xu, Y;Ye, X;Shen, S;Niu, X;Lu, S;Chen, Z;,
FEBS Lett.
,PubMed ID 24928441
[EZH2]
|
Documents
FAQs |
Resources
基因表达相关资源 |