Ku70 (XRCC6) (NM_001469) Human 3' UTR Clone

CAT#: SC203184

3' UTR clone of X-ray repair complementing defective repair in Chinese hamster cells 6 (XRCC6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Ku70 (XRCC6) (NM_001469) Human 3' UTR Clone
Vector pMirTarget
Synonyms CTC75; CTCBF; G22P1; KU70; ML8; TLAA
ACCN NM_001469
Insert Size 256 bp
Sequence Data
>SC203184 3’UTR clone of NM_001469
The sequence shown below is from the reference sequence of NM_001469. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGCCCTCACCAAGCACTTCCAGGACTGACCAGAGGCCGCGCGTCCAGCTGCCCTTCCGCAGTGTGGC
CAGGCTGCCTGGCCTTGTCCTCAGCCAGTTAAAATGTGTTTCTCCTGAGCTAGGAAGAGTCTACCCGAC
ATAAGTCGAGGGACTTTATGTTTTTGAGGCTTTCTGTTGCCATGGTGATGGTGTAGCCCTCCCACTTTG
CTGTTCCTTACTTTACTGCCTGAATAAAGAGCCCTAAGTTTGTACTATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001469.5
Synonyms CTC75; CTCBF; G22P1; KU70; ML8; TLAA
Summary The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
Locus ID 2547
MW 9.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...