Map2k7 (NM_001042557) Mouse Untagged Clone

CAT#: MC216293

Map2k7 (untagged) - Mouse mitogen-activated protein kinase kinase 7 (Map2k7), transcript variant 1, (10ug)



  "NM_001042557" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5930412N11Rik; JNKK 2; Jnkk2; MAPKK 7; Mapkk7; MEK 7; Mek7; Mkk7; Prkmk7; sek2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216293 representing NM_001042557
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGTCCTCCCTGGAGCAGAAGCTGTCCCGCCTGGAAGCCAAGCTGAAGCAGGAGAACCGTGAGG
CCCGCAGGAGGATCGACCTCAACTTGGATATCAGCCCACAGCGGCCCAGGCCCATTATTGTGATCACTCT
AAGCCCTGCTCCTGCCCCGTCCCAGCGAGCAGCCCTGCAACTCCCACTGGCCAACGATGGGGGCAGCCGC
TCACCATCCTCAGAGAGCTCCCCACAGCACCCTACACCCCCCACCCGGCCCCGCCACATGCTGGGGCTCC
CATCAACCTTGTTCACACCGCGCAGTATGGAGAGCATCGAGATTGACCAGAAGCTGCAGGAGATCATGAA
GCAGACAGGGTACCTGACTATCGGGGGCCAGCGTTATCAGGCAGAAATCAATGACTTGGAGAACTTGGGT
GAGATGGGCAGTGGTACCTGTGGTCAGGTGTGGAAGATGCGGTTCCGGAAGACAGGCCACATCATTGCTG
TTAAGCAAATGCGGCGCTCTGGGAACAAGGAAGAGAATAAGCGCATTTTGATGGACCTGGATGTAGTACT
CAAGAGCCATGACTGCCCTTACATCGTTCAGTGCTTTGGCACCTTCATCACCAACACAGACGTCTTTATT
GCCATGGAGCTCATGGGCACATGTGCAGAGAAGCTGAAGAAACGAATGCAGGGCCCCATTCCAGAGCGAA
TCCTGGGCAAGATGACTGTGGCGATTGTGAAAGCACTGTACTATCTGAAGGAGAAGCATGGCGTCATCCA
TCGCGATGTCAAACCCTCCAACATCCTGCTAGATGAGCGGGGCCAGATCAAGCTCTGTGACTTTGGCATC
AGTGGCCGCCTTGTTGACTCCAAAGCCAAAACACGGAGTGCTGGCTGTGCTGCCTATATGGCTCCCGAGC
GCATCGACCCTCCAGATCCCACCAAGCCTGACTATGACATCCGAGCTGATGTGTGGAGCCTGGGCATCTC
ACTGGTGGAGCTGGCAACAGGACAGTTCCCCTATAAGAACTGCAAGACGGACTTTGAGGTCCTCACCAAA
GTCCTACAGGAAGAGCCCCCACTCCTGCCTGGTCACATGGGCTTCTCAGGGGACTTCCAGTCATTTGTCA
AAGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTGAACACAGCTTCATCAA
GCACTATGAGATACTCGAGGTGGATGTCGCGTCCTGGTTTAAGGATGTCATGGCGAAGACCGAGTCCCCA
AGGACTAGTGGAGTCCTGAGTCAGCACCATCTGCCCTTCTTCAGTGGGAGTCTGGAGGAGTCTCCCACTT
CCCCACCTTCTCCCAAGTCCTTCCCTCTGTCACCAGCCATCCCTCAGGCCCAGGCAGAGTGGGTCTCGGG
CAGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001042557
Insert Size 1407 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001042557.2, NP_001036022.1
RefSeq Size 1720 bp
RefSeq ORF 1407 bp
Locus ID 26400
UniProt ID Q8CE90
Gene Summary Dual specificity protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Essential component of the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway. With MAP2K4/MKK4, is the one of the only known kinase to directly activate the stress-activated protein kinase/c-Jun N-terminal kinases MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. MAP2K4/MKK4 and MAP2K7/MKK7 both activate the JNKs by phosphorylation, but they differ in their preference for the phosphorylation site in the Thr-Pro-Tyr motif. MAP2K4/MKK4 shows preference for phosphorylation of the Tyr residue and MAP2K7/MKK7 for the Thr residue. The monophosphorylation of JNKs on the Thr residue is sufficient to increase JNK activity indicating that MAP2K7/MKK7 is important to trigger JNK activity, while the additional phosphorylation of the Tyr residue by MAP2K4/MKK4 ensures optimal JNK activation. Has a specific role in JNK signal transduction pathway activated by proinflammatory cytokines. The MKK/JNK signaling pathway is also involved in mitochondrial death signaling pathway, including the release cytochrome c, leading to apoptosis. Part of a non-canonical MAPK signaling pathway, composed of the upstream MAP3K12 kinase and downstream MAP kinases MAPK1/ERK2 and MAPK3/ERK1, that enhances the AP-1-mediated transcription of APP in response to APOE (PubMed:28111074).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...