SPAG11B (NM_058200) Human Untagged Clone
CAT#: SC305768
SPAG11B (untagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant G
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EDDM2B; EP2; EP2C; EP2D; HE2; HE2C; SPAG11; SPAG11A |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_058200, the custom clone sequence may differ by one or more nucleotides
ATGAGGCAACGATTGCTCCCGTCCGTCACCAGCCTTCTCCTTGTGGCCCTGCTGTTTCCA GGATCGTCTCAAGCCAGACATGTGAACCACTCAGCCACTGAGGCTCTCGGAGAACTCAGG GAAAGAGCCCCTGGGCAAGGCACAAACGGGTTTCAGCTGCTACGCCACGCAGTGAAACGG GACCTCTTACCACCGCGCACCCCACCTTACCAAGGGGATGTTCCACCGGGAATTAGAAAT ACCATCTGCCATATGCAGCAAGGGATCTGCAGACTTTTTTTCTGCCATTCTGGGACAGGC CAGCAGCACAGACAACGCTGTGGATAA |
Restriction Sites | Please inquire |
ACCN | NM_058200 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_058200.1, NP_478107.1 |
RefSeq Size | 755 bp |
RefSeq ORF | 327 bp |
Locus ID | 10407 |
UniProt ID | Q08648 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes several androgen-dependent, epididymis-specific secretory proteins. The specific functions of these proteins have not been determined, but they are thought to be involved in sperm maturation. Some of the isoforms contain regions of similarity to beta-defensins, a family of antimicrobial peptides. The gene is located on chromosome 8p23 near the defensin gene cluster. Alternative splicing of this gene results in seven transcript variants encoding different isoforms. Two different N-terminal and five different C-terminal protein sequences are encoded by the splice variants. Two additional variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (G) is also called the beta2 transcript. It lacks four internal exons. The C-terminus of the resulting isoform (G) is identical to that of isoform H encoded by variant H. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212469 | SPAG11B (Myc-DDK-tagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant G |
CNY 3990.00 |
|
RC212469L3 | Lenti-ORF clone of SPAG11B (Myc-DDK-tagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant G |
CNY 5890.00 |
|
RC212469L4 | Lenti-ORF clone of SPAG11B (mGFP-tagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant G |
CNY 5890.00 |
|
RG212469 | SPAG11B (tGFP-tagged) - Human sperm associated antigen 11B (SPAG11B), transcript variant G |
CNY 4370.00 |
其它SPAG11B产品