SPAG11B (NM_058200) Human Untagged Clone

CAT#: SC305768

SPAG11B (untagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant G



  "NM_058200" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SPAG11B Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EDDM2B; EP2; EP2C; EP2D; HE2; HE2C; SPAG11; SPAG11A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_058200, the custom clone sequence may differ by one or more nucleotides
ATGAGGCAACGATTGCTCCCGTCCGTCACCAGCCTTCTCCTTGTGGCCCTGCTGTTTCCA
GGATCGTCTCAAGCCAGACATGTGAACCACTCAGCCACTGAGGCTCTCGGAGAACTCAGG
GAAAGAGCCCCTGGGCAAGGCACAAACGGGTTTCAGCTGCTACGCCACGCAGTGAAACGG
GACCTCTTACCACCGCGCACCCCACCTTACCAAGGGGATGTTCCACCGGGAATTAGAAAT
ACCATCTGCCATATGCAGCAAGGGATCTGCAGACTTTTTTTCTGCCATTCTGGGACAGGC
CAGCAGCACAGACAACGCTGTGGATAA
Restriction Sites Please inquire     
ACCN NM_058200
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_058200.1, NP_478107.1
RefSeq Size 755 bp
RefSeq ORF 327 bp
Locus ID 10407
UniProt ID Q08648
Protein Families Secreted Protein
Gene Summary This gene encodes several androgen-dependent, epididymis-specific secretory proteins. The specific functions of these proteins have not been determined, but they are thought to be involved in sperm maturation. Some of the isoforms contain regions of similarity to beta-defensins, a family of antimicrobial peptides. The gene is located on chromosome 8p23 near the defensin gene cluster. Alternative splicing of this gene results in seven transcript variants encoding different isoforms. Two different N-terminal and five different C-terminal protein sequences are encoded by the splice variants. Two additional variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (G) is also called the beta2 transcript. It lacks four internal exons. The C-terminus of the resulting isoform (G) is identical to that of isoform H encoded by variant H.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...