CABYR (NM_138644) Human 3' UTR Clone

CAT#: SC200398

3' UTR clone of calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CABYR (NM_138644) Human 3' UTR Clone
Vector pMirTarget
Synonyms CABYRa; CABYRc; CABYRc/d; CABYRe; CBP86; CT88; FSP-2; FSP2
ACCN NM_138644
Insert Size 114 bp
Sequence Data
>SC200398 3’UTR clone of NM_138644
The sequence shown below is from the reference sequence of NM_138644. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACGTCGCAAAGCAGAAACTGAAAACTGATCCAGAAATGACGCTGTCTGGGTCAACATTTCAGGGAGG
AGTCTGCCACCAGTGTAATGTATCAATAAACTTCATGCAAGCATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138644.3
Synonyms CABYRa; CABYRc; CABYRc/d; CABYRe; CBP86; CT88; FSP-2; FSP2
Summary To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
Locus ID 26256
MW 4.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...