Archaemetzincin 2 (AMZ2) (NM_001033570) Human 3' UTR Clone

CAT#: SC202130

3' UTR clone of archaelysin family metallopeptidase 2 (AMZ2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Archaemetzincin 2 (AMZ2) (NM_001033570) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001033570
Insert Size 222 bp
Sequence Data
>SC202130 3' UTR clone of NM_001033570
The sequence shown below is from the reference sequence of NM_001033570. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAATGCCTGGCTGTTCTCCAAAAATGAGGACCTTCAAATAGGAGTGATTGAAATAAATAACTACTTGCAT
GTTATGCTTTCATTTGGGTGGAATACTTCATTGGAATAAACTACTGATCTTGTGCTGTGTCAAAGTAACA
GACTAGAACCTTCTTTCAAGTACCTGAATTGAAATGAAACTCATTTTGAATAATAAAAACTCTAGAAACT
CTTTATCTTCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001033570.1
Summary The protein encoded by this gene is a zinc metalloprotease that displays some activity against angiotensin-3. The encoded protein is inhibited by the aminopeptidase inhibitor amastatin, as well as by the general inhibitors o-phenanthroline and batimastat. Defects in this gene may be associated with lung tumorigenesis. [provided by RefSeq, Oct 2016]
Locus ID 51321
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...