United States
Germany
Japan
United Kingdom
China
Snw1 (BC049245) Mouse Untagged Clone
CAT＃: MC206818
(untagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466, (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310008B08Rik; AW048543; NCoA-62; Skiip; SKIP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206818 representing BC049245.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGGAGCCAAGTGCTAATATGCCTTGGTTCAAGGGATGGAAAGTCACCTGCAAAGATGGCAGTGCC AGTGGCACCACTCTGCTGGAAGCCAGGATAAAGACCAACAGATTTGTTCCTGATAAGGAGTTTTCTGGA TCAGACCGCAAACAGAGAGGCCGAGAAGGACCAGTGCAGTTTGAGGAGGATCCTTTTGGTTTGGACAAG TTTTTGGAAGAAGCCAAACAGCACGGTGGTTCTAAAAGACCCTCTGATAGCAGTCGCCCCAAGGAACAT GAGCATGAAGGCAAGAAGCGGAGGAAAGAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC049245 |
| Insert Size | 309 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC049245 |
| RefSeq Size | 935 bp |
| RefSeq ORF | 308 bp |
| Locus ID | 66354 |
| MW | 11.7 kDa |
| Gene Summary | Involved in pre-mRNA splicing as component of the spliceosome. Is required in the specific splicing of CDKN1A pre-mRNA; the function probably involves the recruitment of U2AF2 to the mRNA. Is proposed to recruit PPIL1 to the spliceosome. May be involved in cyclin-D1/CCND1 mRNA stability through the SNARP complex which associates with both the 3'end of the CCND1 gene and its mRNA. Involved in transcriptional regulation. Modulates TGF-beta-mediated transcription via association with SMAD proteins, MYOD1-mediated transcription via association with PABPN1, RB1-mediated transcriptional repression, and retinoid-X receptor (RXR)- and vitamin D receptor (VDR)-dependent gene transcription in a cell line-specific manner probably involving coactivators NCOA1 and GRIP1. Is involved in NOTCH1-mediated transcriptional activation. Binds to multimerized forms of Notch intracellular domain (NICD) and is proposed to recruit transcriptional coactivators such as MAML1 to form an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ to form a transcriptional activation complex by releasing SNW1 and redundant NOTCH1 NICD.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200327 | (tGFP-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 |
CNY 2,850.00 |
|
| MR200327 | (Myc-DDK-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 |
CNY 1,200.00 |
|
| MR200327L3 | Lenti ORF clone of MGC:55033 (Myc-DDK-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 |
CNY 4,750.00 |
|
| MR200327L4 | Lenti ORF clone of MGC:55033 (mGFP-tagged) - Mouse cDNA clone MGC:55033 IMAGE:4949466 |
CNY 4,750.00 |
