Il6 (NM_031168) Mouse Untagged Clone
CAT#: MC208786
Il6 (untagged) - Mouse interleukin 6 (Il6), (10ug)
CNY 3,600.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Il; Il-6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208786 representing NM_031168
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGTTCCTCTCTGCAAGAGACTTCCATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGG CCTTCCCTACTTCACAAGTCCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATAC CACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGC AATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATAC AAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCT TCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGA GTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAG TCCTTCCTACCCCAATTTCCAATGCTCTCCTAACAGATAAGCTGGAGTCACAGAAGGAGTGGCTAAGGAC CAAGACCATCCAATTCATCTTGAAATCACTTGAAGAATTTCTAAAAGTCACTTTGAGATCTACTCGGCAA ACCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_031168 |
Insert Size | 636 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC132458, AAI32459 |
RefSeq Size | 709 bp |
RefSeq ORF | 636 bp |
Locus ID | 16193 |
UniProt ID | P08505 |
Gene Summary | This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Interleukin-6 gene transfer reverses body weight gain and fatty liver in obese mice
,Ma, Y;Gao, M;Sun, H;Liu, D;,
Biochim. Biophys. Acta
,PubMed ID 25660446
[IL6]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227281 | Il6 (tGFP-tagged) - Mouse interleukin 6 (Il6), (10ug) |
CNY 5,200.00 |
|
MR227281 | Il6 (Myc-DDK-tagged) - Mouse interleukin 6 (Il6) |
CNY 3,600.00 |
|
MR227281L1 | Lenti ORF clone of Il6 (Myc-DDK-tagged) - Mouse interleukin 6 (Il6) |
CNY 5,890.00 |
|
MR227281L2 | Lenti ORF clone of Il6 (mGFP-tagged) - Mouse interleukin 6 (Il6) |
CNY 6,000.00 |
|
MR227281L3 | Lenti ORF clone of Il6 (Myc-DDK-tagged) - Mouse interleukin 6 (Il6) |
CNY 6,000.00 |
|
MR227281L4 | Lenti ORF clone of Il6 (mGFP-tagged) - Mouse interleukin 6 (Il6) |
CNY 6,000.00 |