Cd44 (NM_001177787) Mouse Untagged Clone

CAT#: MC216250

Cd44 (untagged) - Mouse CD44 antigen (Cd44), transcript variant 6, (10ug)



  "NM_001177787" in other vectors (4)

CNY 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
CD44 (Pgp, Ly-24,Hyaluronan Receptor), rat anti mouse, clone IM7.8.1
    • 200 ug

CNY 6,450.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AU023126; AW121933; AW146109; HERMES; Ly-24; Pgp-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216250 representing NM_001177787
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACAAGTTTTGGTGGCACACAGCTTGGGGACTTTGCCTCTTGCAGTTGAGCCTGGCACATCCACATC
AGCAGATCGATTTGAATGTAACCTGCCGCTACGCAGGTGTATTCCATGTGGAGAAAAATGGCCGCTACAG
TATCTCCCGGACTGAGGCAGCTGACCTCTGCCAGGCTTTCAACAGTACCTTACCCACCATGGACCAAATG
AAGTTGGCCCTGAGCAAGGGTTTTGAAACATGCAGGTATGGGTTCATAGAAGGAAATGTGGTAATTCCGA
GGATTCATCCCAACGCTATCTGTGCAGCCAACCACACAGGAGTATATATCCTCGTCACGTCCAACACCTC
CCACTATGACACATATTGCTTCAATGCCTCAGCCCCTCCTGAAGAAGACTGTACATCAGTCACAGACCTA
CCCAATTCCTTCGATGGACCGGTTACCATAACTATTGTCAACCGTGATGGTACTCGCTACAGCAAGAAGG
GCGAGTATAGAACACACCAAGAAGACATCGATGCTTCAAACATTATAGATGACGATGTCAGCAGCGGCTC
CACCATCGAGAAGAGCACCCCAGAAAGCTACATTTTGCACACCTACCTTCCTACTGAACAGCCTACTGGA
GATCAGGATGACTCCTTCTTTATCCGGAGCACCTTGGCCACCACACAGAGTCATTCTCAGAACTTCTCTA
CATTACATGGAGAGCCGGAAGAAGACGAAAACCATCCAACAACTTCTATTCTGCCATCTAGCACTAAGAG
CGGCGCTAAAGATGCAAGAAGAGGTGGAAGTCTTCCCACAGATACAACTACTTCTGTAGAAGGCTACACC
TTTCAATACCCAGACACAATGGAAAATGGGACTCTCTTCCCAGTGACCCCTGCTAAAACTGAGGTCTTTG
GAGAAACTGAAGTGACTCTTGCTACTGACTCCAACGTTAATGTTGATGGCTCCTTACCAGGAGATCGAGA
CTCATCCAAGGACTCCAGGGGGAGTTCCCGCACTGTGACTCATGGATCCGAATTAGCTGGACACTCAAGT
GCGAACCAGGACAGTGGAGTGACCACAACTTCTGGTCCTATGAGGAGACCTCAGATTCCAGAATGGCTCA
TCATCTTGGCATCTCTCCTGGCACTGGCTCTGATTCTTGCCGTCTGCATCGCGGTCAATAGTAGGAGAAG
GTGTGGGCAGAAGAAAAAGCTGGTGATCAACGGTGGCAATGGGACGGTGGAAGACAGGAAACCCAGTGAG
CTCAACGGGGAGGCCAGCAAGTCTCAGGAAATGGTGCATTTGGTGAACAAGGAACCATCAGAGACCCCGG
ACCAGTGTATGACAGCTGACGAGACCCGGAATCTGCAGAGTGTGGACATGAAGATTGGGGTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177787
Insert Size 1395 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001177787.1, NP_001171258.1
RefSeq Size 4706 bp
RefSeq ORF 1395 bp
Locus ID 12505
UniProt ID P15379
Gene Summary Cell-surface receptor that plays a role in cell-cell interactions, cell adhesion and migration, helping them to sense and respond to changes in the tissue microenvironment. Participates thereby in a wide variety of cellular functions including the activation, recirculation and homing of T-lymphocytes, hematopoiesis, inflammation and response to bacterial infection. Engages, through its ectodomain, extracellular matrix components such as hyaluronan/HA, collagen, growth factors, cytokines or proteases and serves as a platform for signal transduction by assembling, via its cytoplasmic domain, protein complexes containing receptor kinases and membrane proteases (PubMed:8343954, PubMed:25065622). Such effectors include PKN2, the RhoGTPases RAC1 and RHOA, Rho-kinases and phospholipase C that coordinate signaling pathways promoting calcium mobilization and actin-mediated cytoskeleton reorganization essential for cell migration and adhesion (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks several alternate, in-frame, exons, compared to variant 1. The resulting protein (isoform f) is shorter when it is compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...