Atf4 (NM_001287180) Mouse Untagged Clone

CAT#: MC227200

Atf4 (untagged) - Mouse activating transcription factor 4 (Atf4), transcript variant 2



  "NM_001287180" in other vectors (1)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Atf4 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Atf-4; C/ATF; CREB2; TAXREB67
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227200 representing NM_001287180
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCGAGATGAGCTTCCTGAACAGCGAAGTGTTGGCGGGGGACTTGATGTCCCCCTTCGACCAGTCGG
GTTTGGGGGCTGAAGAAAGCCTAGGTCTCTTAGATGACTATCTGGAGGTGGCCAAGCACTTGAAACCTCA
TGGGTTCTCCAGCGACAAGGCGGGCTCCTCGGAATGGCCGGCTATGGATGATGGCTTGGCCAGTGCCTCA
GACACCGGCAAGGAGGATGCCTTTTCCGGGACAGATTGGATGTTGGAGAAAATGGATCTGAAAGAGTTTG
ACTTCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTCTTGACCACGTTGGATGA
CACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATT
GGCCATCTCCCAGAAAGTTTAATAAAAGTCGACCAGGTTGCCCCCTTTACATTCTTGCAGCCTTTCCCCT
GTTCCCCAGGGGTTCTGTCTTCCACTCCAGAGCATTCCTTTAGTTTAGAGCTAGGCAGTGAAGTTGATAT
CTCTGAAGGAGACAGGAAGCCTGACTCTGCTGCTTACATTACTCTAATCCCTCCATGTGTAAAGGAGGAA
GACACTCCCTCTGACAATGACAGTGGCATCTGTATGAGCCCAGAGTCCTACCTGGGCTCTCCCCAGCATA
GCCCCTCCACCTCCAGGGCCCCACCAGACAATCTGCCTTCTCCAGGTGGTTCCCGTGGGTCTCCTCGGCC
CAAACCTTATGACCCACCTGGAGTTAGTTTGACAGCTAAAGTGAAGACTGAGAAATTGGATAAGAAGCTG
AAAAAGATGGAGCAAAACAAGACAGCAGCCACTAGGTACCGCCAGAAGAAGCGGGCTGAGCAGGAGGCCC
TCACTGGCGAGTGTAAGGAGCTAGAAAAAAAGAATGAGGCTCTGAAAGAGAAGGCAGATTCTCTGGCCAA
GGAGATCCAGTATCTGAAAGACCTGATAGAAGAGGTCCGTAAGGCAAGGGGGAAGAAGAGAGTTCCGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001287180
Insert Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287180.1, NP_001274109.1
RefSeq Size 1463 bp
RefSeq ORF 1050 bp
Locus ID 11911
UniProt ID Q06507
Gene Summary Transcriptional activator. Binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3'), a sequence present in many viral and cellular promoters. Binds to asymmetric CRE's as a heterodimer and to palindromic CRE's as a homodimer. Cooperates with FOXO1 in osteoblasts to regulate glucose homeostasis through suppression of beta-cell production and decrease in insulin production. Regulates the induction of DDIT3/CHOP and asparagine synthetase (ASNS) in response to ER stress. In concert with DDIT3/CHOP, activates the transcription of TRIB3 and promotes ER stress-induced neuronal apoptosis by regulating the transcriptional induction of BBC3/PUMA. Activates transcription of SIRT4. Regulates the circadian expression of the core clock component PER2 and the serotonin transporter SLC6A4. Binds in a circadian time-dependent manner to the cAMP response elements (CRE) in the SLC6A4 and PER2 promoters and periodically activates the transcription of these genes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an internal segment in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...