SLC22A6 (NM_153276) Human Untagged Clone
CAT#: SC123302
SLC22A6 (untagged)-Human solute carrier family 22 (organic anion transporter), member 6 (SLC22A6), transcript variant 2
CNY 6,560.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HOAT1; OAT1; PAHT; ROAT1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_153276, the custom clone sequence may differ by one or more nucleotides
ATGGCCTTTAATGACCTCCTGCAGCAGGTGGGGGGTGTCGGCCGCTTCCAGCAGATCCAGGTCACCCTGG TGGTCCTCCCCCTGCTCCTGATGGCTTCTCACAACACCCTGCAGAACTTCACTGCTGCCATCCCTACCCA CCACTGCCGCCCGCCTGCCGATGCCAACCTCAGCAAGAACGGGGGGCTGGAGGTCTGGCTGCCCCGGGAC AGGCAGGGGCAGCCTGAGTCCTGCCTCCGCTTCACCTCCCCGCAGTGGGGACTGCCCTTTCTCAATGGCA CAGAAGCCAATGGCACAGGGGCCACAGAGCCCTGCACCGATGGCTGGATCTATGACAACAGCACCTTCCC ATCTACCATCGTGACTGAGTGGGACCTTGTGTGCTCTCACAGGGCCCTACGCCAGCTGGCCCAGTCCTTG TACATGGTGGGGGTGCTGCTCGGAGCCATGGTGTTCGGCTACCTTGCAGACAGGCTAGGCCGCCGGAAGG TACTCATCTTGAACTACCTGCAGACAGCTGTGTCAGGGACCTGCGCAGCCTTCGCACCCAACTTCCCCAT CTACTGCGCCTTCCGGCTCCTCTCGGGCATGGCTCTGGCTGGCATCTCCCTCAACTGCATGACACTGAAT GTGGAGTGGATGCCCATTCACACACGGGCCTGCGTGGGCACCTTGATTGGCTATGTCTACAGCCTGGGCC AGTTCCTCCTGGCTGGTGTGGCCTACGCTGTGCCCCACTGGCGCCACCTGCAGCTACTGGTCTCTGCGCC TTTTTTTGCCTTCTTCATCTACTCCTGGTTCTTCATTGAGTCGGCCCGCTGGCACTCCTCCTCCGGGAGG CTGGACCTCACCCTGAGGGCCCTGCAGAGAGTCGCCCGGATCAATGGGAAGCGGGAAGAAGGAGCCAAAT TGAGTATGGAGGTACTCCGGGCCAGTCTGCAGAAGGAGCTGACCATGGGCAAAGGCCAGGCATCGGCCAT GGAGCTGCTGCGCTGCCCCACCCTCCGCCACCTCTTCCTCTGCCTCTCCATGCTGTGGTTTGCCACTAGC TTTGCATACTATGGGCTGGTCATGGACCTGCAGGGCTTTGGAGTCAGCATCTACCTAATCCAGGTGATCT TTGGTGCTGTGGACCTGCCTGCCAAGCTTGTGGGCTTCCTTGTCATCAACTCCCTGGGTCGCCGGCCTGC CCAGATGGCTGCACTGCTGCTGGCAGGCATCTGCATCCTGCTCAATGGGGTGATACCCCAGGACCAGTCC ATTGTCCGAACCTCTCTTGCTGTGCTGGGGAAGGGTTGTCTGGCTGCCTCCTTCAACTGCATCTTCCTGT ATACTGGGGAACTGTATCCCACAATGATCCGGCAGACAGGCATGGGAATGGGCAGCACCATGGCCCGAGT GGGCAGCATCGTGAGCCCACTGGTGAGCATGACTGCCGAGCTCTACCCCTCCATGCCTCTCTTCATCTAC GGTGCTGTTCCTGTGGCCGCCAGCGCTGTCACTGTCCTCCTGCCAGAGACCCTGGGCCAGCCACTGCCAG ACACGGTGCAGGACCTGGAGAGCAGGAAAGGGAAACAGACGCGACAGCAACAAGAGCACCAGAAGTATAT GGTCCCACTGCAGGCCTCAGCACAAGAGAAGAATGGACTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_153276 |
Insert Size | 2180 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153276.1, NP_695008.1 |
RefSeq Size | 2194 bp |
RefSeq ORF | 1653 bp |
Locus ID | 9356 |
UniProt ID | Q4U2R8 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is involved in the sodium-dependent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and may be localized to the basolateral membrane. Four transcript variants encoding four different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2, also called OAT1-2) lacks an alternate in-frame segment compared to variant 1, resulting in a shorter isoform (b) compared to isoform a. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Evaluation of the Effect of Cobicistat on the In Vitro Renal Transport and Cytotoxicity Potential of Tenofovir
,null,
Antimicrobial Agents and Chemotherapy
,PubMed ID 23896476
[SLC22A6]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207579 | SLC22A6 (Myc-DDK-tagged)-Human solute carrier family 22 (organic anion transporter), member 6 (SLC22A6), transcript variant 2 |
CNY 6,144.00 |
|
RC207579L1 | Lenti ORF clone of Human solute carrier family 22 (organic anion transporter), member 6 (SLC22A6), transcript variant 2, Myc-DDK-tagged |
CNY 8,544.00 |
|
RC207579L2 | Lenti ORF clone of Human solute carrier family 22 (organic anion transporter), member 6 (SLC22A6), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC207579L3 | Lenti ORF clone of Human solute carrier family 22 (organic anion transporter), member 6 (SLC22A6), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC207579L4 | Lenti ORF clone of Human solute carrier family 22 (organic anion transporter), member 6 (SLC22A6), transcript variant 2, mGFP tagged |
CNY 8,544.00 |
|
RG207579 | SLC22A6 (tGFP-tagged) - Human solute carrier family 22 (organic anion transporter), member 6 (SLC22A6), transcript variant 2 |
CNY 7,744.00 |
其它SLC22A6产品