TPM1 (NM_001018020) Human Untagged Clone
CAT#: SC302127
TPM1 (untagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 7
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302127 representing NM_001018020.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAGGAGAACGCCTTGGATCGAGCTGAG CAGGCGGAGGCCGACAAGAAGGCGGCGGAAGACAGGAGCAAGCAGCTCGAGGAGGACATCGCGGCCAAG GAGAAGTTGCTGCGGGTGTCGGAGGACGAGCGGGACCGGGTGCTGGAGGAGCTGCACAAGGCGGAGGAC AGCCTCCTGGCCGCCGAAGAGGCCGCCGCCAAGGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATC CAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAA GCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAA GAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAA TATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAG CTCTCAGAAGGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTA ATGGCTGCAGAGGATAAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGAC AAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATT GATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTATGCATCAGATGCTGGATCAG ACTTTACTGGAGTTAAACAACATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001018020 |
Insert Size | 855 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001018020.1 |
RefSeq Size | 1797 bp |
RefSeq ORF | 855 bp |
Locus ID | 7168 |
UniProt ID | P09493 |
Protein Families | Druggable Genome |
Protein Pathways | Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM) |
MW | 32.8 kDa |
Gene Summary | This gene is a member of the tropomyosin family of highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosin is composed of two alpha-helical chains arranged as a coiled-coil. It is polymerized end to end along the two grooves of actin filaments and provides stability to the filaments. The encoded protein is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle, where it also functions in association with the troponin complex to regulate the calcium-dependent interaction of actin and myosin during muscle contraction. In smooth muscle and non-muscle cells, alternatively spliced transcript variants encoding a range of isoforms have been described. Mutations in this gene are associated with type 3 familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (Tpm1.3, also known as variant 7) contains alternate, in-frame exons in the coding region, compared to variant Tpm1.1. It encodes isoform Tpm1.3sm, which has distinct N- and C-termini, compared to isoform Tpm1.1st. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218995 | TPM1 (Myc-DDK-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 7 |
CNY 2,400.00 |
|
RC218995L3 | Lenti-ORF clone of TPM1 (Myc-DDK-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 7 |
CNY 5,890.00 |
|
RC218995L4 | Lenti-ORF clone of TPM1 (mGFP-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 7 |
CNY 5,890.00 |
|
RG218995 | TPM1 (tGFP-tagged) - Human tropomyosin 1 (alpha) (TPM1), transcript variant 7 |
CNY 4,370.00 |