United States
Germany
Japan
United Kingdom
China
KCNJ15 (NM_170736) Human Untagged Clone
CAT＃: SC309509
KCNJ15 (untagged)-Human potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IRKK; KIR1.3; KIR4.2 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_170736, the custom clone sequence may differ by one or more nucleotides
ATGGATGCCATTCACATCGGCATGTCCAGCACCCCCCTGGTGAAGCACACTGCTGGGGCTGGGCTCAAGG CCAACAGACCCCGCGTCATGTCCAAGAGTGGGCACAGCAACGTGAGAATTGACAAAGTGGATGGCATATA CCTACTCTACCTGCAAGACCTGTGGACCACAGTTATCGACATGAAGTGGAGATACAAACTCACCCTGTTC GCTGCCACTTTTGTGATGACCTGGTTCCTTTTTGGAGTCATCTACTATGCCATCGCGTTTATTCATGGGG ACTTAGAACCCGGTGAGCCCATTTCAAATCATACCCCCTGCATCATGAAAGTGGACTCTCTCACTGGGGC GTTTCTCTTTTCCCTGGAATCCCAGACAACCATTGGCTATGGAGTCCGTTCCATCACAGAGGAATGTCCT CATGCCATCTTCCTGTTGGTTGCTCAGTTGGTCATCACGACCTTGATTGAGATCTTCATCACCGGAACCT TCCTGGCCAAAATCGCCAGACCCAAAAAGCGGGCTGAGACCATCAAGTTCAGCCACTGTGCAGTCATCAC CAAGCAGAATGGGAAGCTGTGCTTGGTGATTCAGGTAGCCAATATGAGGAAGAGCCTCTTGATTCAGTGC CAGCTCTCTGGCAAGCTCCTGCAGACCCACGTCACCAAGGAGGGGGAGCGGATTCTCCTCAACCAAGCCA CTGTCAAATTCCACGTGGACTCCTCCTCTGAGAGCCCCTTCCTCATTCTGCCCATGACATTCTACCATGT GCTGGATGAGACGAGCCCCCTGAGAGACCTCACACCCCAAAACCTAAAGGAGAAGGAGTTTGAGCTTGTG GTCCTCCTCAATGCCACTGTGGAATCCACCAGCGCTGTCTGCCAGAGCCGAACATCTTATATCCCAGAGG AAATCTACTGGGGTTTTGAGTTTGTGCCTGTGGTATCTCTCTCCAAAAATGGAAAATATGTGGCTGATTT CAGTCAGTTTGAACAGATTCGGAAAAGCCCAGATTGCACATTTTACTGTGCAGATTCTGAGAAACAGCAA CTCGAGGAGAAGTACAGGCAGGAGGATCAGAGGGAAAGAGAACTGAGGACACTTTTATTACAACAGAGCA ATGTCTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_170736 |
| Insert Size | 4700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_170736.1, NP_733932.1 |
| RefSeq Size | 2919 bp |
| RefSeq ORF | 1128 bp |
| Locus ID | 3772 |
| UniProt ID | Q99712 |
| Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
| Gene Summary | Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013] Transcript Variant: This variant (1) represents the longest transcript. All eight variants encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217854 | KCNJ15 (Myc-DDK-tagged)-Human potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 1 |
CNY 3,656.00 |
|
| RC217854L3 | Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217854L4 | Lenti ORF clone of Human potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG217854 | KCNJ15 (tGFP-tagged) - Human potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 1 |
CNY 4,370.00 |
