United States
Germany
Japan
United Kingdom
China
FDPS (NM_002004) Human Untagged Clone
CAT＃: SC310416
FDPS (untagged)-Human farnesyl diphosphate synthase (FDPS), transcript variant 1
CNY 3,656.00
CNY 6,750.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FPPS; FPS; POROK9 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002004 edited
ATGCCCCTGTCCCGCTGGTTGAGATCTGTGGGGGTCTTCCTGCTGCCAGCCCCCTACTGG GCACCCCGGGAGAGGTGGCTGGGTTCCCTACGGCGGCCCTCCCTGGTGCACGGGTACCCA GTCCTGGCCTGGCACAGTGCCCGCTGCTGGTGCCAAGCGTGGACAGAGGAACCTCGAGCC CTTTGCTCCTCCCTCAGAATGAACGGAGACCAGAATTCAGATGTTTATGCCCAAGAAAAG CAGGATTTCGTTCAGCACTTCTCCCAGATCGTTAGGGTGCTGACTGAGGATGAGATGGGG CACCCAGAGATAGGAGATGCTATTGCCCGGCTCAAGGAGGTCCTGGAGTACAATGCCATT GGAGGCAAGTATAACCGGGGTTTGACGGTGGTAGTAGCATTCCGGGAGCTGGTGGAGCCA AGGAAACAGGATGCTGATAGTCTCCAGCGGGCCTGGACTGTGGGCTGGTGTGTGGAACTG CTGCAAGCTTTCTTCCTGGTGGCAGATGACATCATGGATTCATCCCTTACCCGCCGGGGA CAGATCTGCTGGTATCAGAAGCCGGGCGTGGGTTTGGATGCCATCAATGATGCTAACCTC CTGGAAGCATGTATCTACCGCCTGCTGAAGCTCTATTGCCGGGAGCAGCCCTATTACCTG AACCTGATCGAGCTCTTCCTGCAGAGTTCCTATCAGACTGAGATTGGGCAGACCCTGGAC CTCCTCACAGCCCCCCAGGGCAATGTGGATCTTGTCAGATTCACTGAAAAGAGGTACAAA TCTATTGTCAAGTACAAGACAGCTTTCTACTCCTTCTACCTTCCTATAGCTGCAGCCATG TACATGGCAGGAATTGATGGCGAGAAGGAGCACGCCAATGCCAAGAAGATCCTGCTGGAG ATGGGGGAGTTCTTTCAGATTCAGGATGATTACCTTGACCTCTTTGGGGACCCCAGTGTG ACCGGCAAAATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGT CTGCAACGGGCCACTCCAGAACAGTACCAGATCCTGAAGGAAAATTACGGGCAGAAGGAG GCTGAGAAAGTGGCCCGGGTGAAGGCGCTATATGAGGAGCTGGATCTGCCAGCAGTGTTC TTGCAATATGAGGAAGACAGTTACAGCCACATTATGGCTCTCATTGAACAGTACGCAGCA CCCCTGCCCCCAGCCGTCTTTCTGGGGCTTGCGCGCAAAATCTACAAGCGGAGAAAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_002004 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002004.2, NP_001995.1 |
| RefSeq Size | 1345 bp |
| RefSeq ORF | 1260 bp |
| Locus ID | 2224 |
| UniProt ID | P14324 |
| Domains | polyprenyl_synt |
| Protein Families | Druggable Genome |
| Protein Pathways | Metabolic pathways, Terpenoid backbone biosynthesis |
| Gene Summary | This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203499 | FDPS (Myc-DDK-tagged)-Human farnesyl diphosphate synthase (FDPS), transcript variant 1 |
CNY 3,656.00 |
|
| RC203499L1 | Lenti ORF clone of Human farnesyl diphosphate synthase (FDPS), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC203499L2 | Lenti ORF clone of Human farnesyl diphosphate synthase (FDPS), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC203499L3 | Lenti ORF clone of Human farnesyl diphosphate synthase (FDPS), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC203499L4 | Lenti ORF clone of Human farnesyl diphosphate synthase (FDPS), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG203499 | FDPS (tGFP-tagged) - Human farnesyl diphosphate synthase (FDPS), transcript variant 1 |
CNY 4,370.00 |
